Briefly, forward primer 5′-TATTGCTTTTGAGAGGTTTTGTTACTTTG-3′ and reverse primer ACCTCTGACATCTGAATACGAATGC and the probe FAM-ACGGGTAGTCATGATTGAGTT-MGB-BHQ (Integrated DNA Technologies-IDT) were used. PCR reaction mixture consisted of 7.5 μL of 2X NZYSupreme qPCR Probe master mix (NZYTECH,...
( G o b j ) as the human representation system to measure the object recognizing ability of visual encoders ( M ) of multimodal large language models (MLLMs), Pfram shows strong and robust correlation with MLLM object hallucination (POPE acc) across different similarity metrics ( ϕ ) ...
4.1 Basic RTP Payload Format Examples 4.2 Extended RTP Payload Format Examples 4.3 FEC RTP Payload Format Examples 4.3 FEC RTP Payload Format Examples 4.3.1 I-Frame 4.3.1 I-Frame 4.3.1.1 FEC Metadata Packet (FEC Version 0) 4.3.1.2 FEC Metadata Packet (FEC Version 1) 4.3.2 SP...
ACC filter pin 3 APC1 filter fsc APC circuit filter pin 4 X'tal VCXO circuit X'tal pin 5 6 7 GND1 GND2 fsc GND pin 4fsc GND pin fsc output Outputs subcarrier synchronized to input chroma signal NTSC : 3.579545MHz PAL : 4.433619MHz 4fsc Clock Generator MM1093 ...
The predicted band sizes of 15.9 kb after Bgl II digestion with the 5′ probe and 13.5 kb after Acc65 I digestion with the 3′ probe confirm the homologous recombination of the external cassette. The transformed PFTK1 allele was easily detectable in the transformed mice through the agouti ...
format(ckpt)) logger.info(':::Start validation:::') i = 0 acc_top_1, acc_top_k = 0.0, 0.0 try: while not coord.should_stop(): i += 1 start_time = time.time() test_images_batch, test_labels_batch = sess.run([test_images, test_labels]) feed_dict = {graph['images']: ...
VBAT_REG_ACC IICHG_REG_ACC ICHG_20pct Charge voltage regulation accuracy Fast charge current regulation accuracy Charge current with 20% option on VBAT = 4.112 V and 4.208 V VBAT = 3.8 V, ICHG = 1024 mA, TJ = 25°C VBAT = 3.8 V, ICHG = 1024 mA, TJ = -20°C – 125°C ...
[MS-RTVPF]: RTP Payload Format for RT Video Streams Extensions [MS-RTVPF]: RTP Payload Format for RT Video Streams Extensions 1 Introduction 2 Messages 3 Protocol Details 4 Protocol Examples 4 Protocol Examples 4.1 Basic RTP Payload Format Examples 4.2 Extended RTP Payload Format Exa...
(v) << PF_DIAG_CH_PROP_ACC_POS; \ } while (0) /* ch_properties diagnosis severity See also pnet_diag_ch_prop_maint_values_t */ #define PF_DIAG_CH_PROP_MAINT_MASK 0x0600 #define PF_DIAG_CH_PROP_MAINT_POS 9 #define PF_DIAG_CH_PROP_MAINT_GET(x) \ (((x)&PF_DIAG_CH_...
4.1 Basic RTP Payload Format Examples 4.2 Extended RTP Payload Format Examples 4.3 FEC RTP Payload Format Examples 4.3 FEC RTP Payload Format Examples 4.3.1 I-Frame 4.3.1 I-Frame 4.3.1.1 FEC Metadata Packet (FEC Version 0) 4.3.1.2 FEC Metadata Packet (FEC Version 1) 4.3.2 SP-F...