International Classes: C12N15/02; A61K31/00; A61K38/00; A61K39/00; A61K39/395; A61P15/00; A61P15/16; A61P15/18; C07K14/00; C07K14/47; C07K14/705; C07K16/00; C07K16/18; C12N1/19; C12N1/21; C12N5/10; C12N15/09; C12N15/12; C12P21/00; C12P21/08; C12R1/19;...
International Classes: C12N15/113;A61P25/00 View Patent Images: Download PDF 20230174979 Primary Examiner: CENTRAL, DOCKET Attorney, Agent or Firm: GREENBERG TRAURIG, LLP (BOS) (BOSTON, MASSACHUSETTS, US) Claims: 1.An antisense nucleobase oligomer comprising 8-40 nucleobases, wherein at least ...
The seven SIRTs are divided into four classes, as follows: class I (consisting of SIRT1, SIRT2, and SIRT3), class II (SIRT4), class III (SIRT5), and class IV (SIRT6 and SIRT7); they differ with respect to their distribution in tissues and their intracellular locations. SIRT1, ...
Then, as soon as inflammation is significantly diminished both classes of drugs would contribute to a reduction of ECM in the lung, but their concentrations should be carefully adjusted to avoid continuous matrix decrease and tissue loss as side effects. Thus, our findings might have implications ...
Based on functional annotation of the ORFs, a total of 31 antibiotic resistance genes were identified in the genome sequences of the chromosome (1/31), pR47-54 (10/31), and pR47-309 (20/31) (Table 6), which were involved in resistance to 9 classes of antibiotics (β-lactams, amphe...
HCV06(sequence ID NO: 6) acccactctatgTccggtcatttgg 2b HCV07(sequence ID NO: 7) ctctatgcccAgccatttggg 2c HCV08(sequence ID NO: 8) aatcgctgggGtgaccgggtc 3a HCV10(sequence ID NO: 9) cccgcgagatCactagccgag 3a, 3b HCV11(sequence ID NO: 10) tagtatgagtgtTgtacagcctcca 4a HCV12(...
(2):242-255). Höfte and Whiteley classified B.t. crystal protein genes into four major classes. The classes were CryI (Lepidoptera-specific), CryII (Lepidoptera- and Diptera-specific), CryIII (Coleoptera-specific), and CryIV (Diptera-specific). The discovery of strains specifically toxic...
TCCATGGCCTGACAATTTACCTTCTATTTGGGTAATTTATTGTCCCTTAC GCAAACTCTCCAACTGTCATTGCACAGACATATGATCTGTATTTAGCTCT CACTTTAGGTGTTTCCATTGATTCTATTCTCACTAATGTGCTTCAGGTAT ATCCCT Upstream HLA-DRα (522 bp): (SEQ ID NO: 36) TAGGCTTTGCCCATTATACTCTCTCATATTCATTGACCTGAATCCTCAAA TGAGGTGTGTCCATTAGTCAACTCCAATCTCTTGT...
synthetic tailoring has been the primary strategy for enhancing established core scaffolds through analog generation. Although this approach has been fruitful, no major classes of new antibiotics were introduced between 1962 and 2000.4Therefore, to restore robust access to effective therapeutic agents, it...
International Classes: C07K16/24;C12N15/62 View Patent Images: Download PDF 20190048071 US Patent References: Other References: Brorson et al. J. Immunol; 1999; Vol. 163, pages 6694-6701. Kobayashi et al. Protein Engineering; 1999; Vol. 12, pages 879-844. ...