Supplementary Table 2 . Oligonucleotides used in this study .Number, Library ConditionAverage, AverageEarly, Exponential
used in this study. Yeast strains, plasmids, and oligonucleotides used in this study.Yeast strains, plasmids, and oligonucleotides used in this study.Natalie, LuhtalaRoy, Parker
Scientific Reports | 7:39898 | DOI: 10.1038/srep39898 2 www.nature.com/scientificreports/ Table 1. Oligonucleotides sequences used in this study. HpE6rep6 and HpE2rep2 are composed of a PPRH motif (HpE6 and HpE2 domain, bold font) and of a 25 nucleotide single-stranded extension ...
The sequences and structures of oligonucleotides used in the study are shown in Fig. 1A. Both IMO immunomers 2 and 3 contain a novel structure. In these sequences two short nucleotide segments, containing appropriate stimulatory motifs, are attached through a glycerol linker (shown as X in ...
The sequences of the oligonucleotides used in this and later experiments are shown in TableI. Two oligonucleotides, GRO29A and GRO15A, consistently inhibited proliferation in all of the cell lines tested. For three of the cell lines, GRO29A had a more potent inhibitory effect than GRO15A (...
Table 1 Wild-type and mutant template sequences, and 'bubble-forming' oligonucleotide sequences used in this study Name Oligonucleotide sequence (5' > 3')a, b Wild-type sense template AGATTAAGAGAACCAACACCTCT Wild-type antisense template AGAGGTGTTGGTTCTCTTAATCT Mutant sense template AGATTAAGAGA...
However, the observation here may be attributed to the significantly lower enzyme concentration used in this study (0.1 U/μl compared to 2.5-40X higher concentrations reported previously [2, 3, 5, 15]), together with the careful matching of annealing temperature to each oligonucleotide ...
HTT ASO: The ASO used in this study was designed to target intron 22 of the human HTT transcript. The HTT ASO is a gapmer with a phosphorothioate backbone and locked nucleic acid (LNA) wing modifications (+T*+A*+A*+T*+A*C*G*T*A*A*G*T*G*T*+C*+A*+C*+A*+A; + = LNA ...
The determination of the transcriptional profiles of MM.1S cells exposed to ASOs and genome-scale CRISPR studies, to identify the genes whose editing, or activation influence the cellular response, were amongst the methods used in this study. Based on the transcriptional profiles, it was ...
Inhibition of p210bcr-abl immunoprecipitation was not seen with the other ODNs used in this study (data now shown). EXAMPLE 9Effects of oligodeoxynucleotides upon K562 cell growthTo evaluate the effects of these various ODNs of K562 cell growth, both growth in liquid culture and growth in ...