Making a donation is an act of generosity. Your support, however modest it might be, is necessary. Be it because you love or enjoy Anti-Adblock Killer. Your donations help to continue to support and improve this
DNA structures like repeats, genes, chromosomes, centromere, telomeres etc - which otherwise would appear as incredibly thin 1-pixel-thick lines. Why on Earth? I got the idea while looking at raw DNA and pondering if that advent of 4K monitors mite allow me to "See" all the information. ...
ЧтотакоеЛегкая Gt-Kc-Dudu Кролик-Розовый 2m-48m ПиксельныйДиапазон 100*63*50mm УличнаяЦифроваяКамерадляДетей, 1 производи...
Hydra Riox1 and Riox2 were amplified from cDNA (Hydra vulgaris, total RNA extracted from whole animals, primer: hyNO66_NheF 5’-CAGGCTAGCATGAATAACAACAAAGTATCAGC-3′, hyNO66_XmaR 5’-GACCCGGGTGTATGGACCAATGGAACC-3′ for Riox1, and hyMina53_NheF CAGGCTAGCATGGTGAAACGCAAAGGTTC, hyMina...