ATM pre-intra-polyAdenilation/ex2_R: GCATCCCAATTCAAATATTTTC This paper N/A ATM post-intra-polyAdenilation ex3_R: GCTTGTGTTGAGGCTGATAC This paper N/A ATM post-intra-polyAdenilation ex15_F: GATCGCTGTCTTCTGGGATT This paper N/A ATM post-intra-polyAdenilation ex15_R: CCTGCACATTGCATTA...
They account for around 15–20% of all breast cancer and do not respond to targeted therapies such as endocrine therapy. As such, chemotherapy, which can be administered first-line or in the adjuvant and neoadjuvant settings, often remains the only option for TNBC patients [1, 2]. Taxols ...
DIF can be addressed in two ways: account for DIF by generating individual scores through modeling approaches or eliminate items to create a DIF-free instrument [49]. We elected to eliminate items to make results comparable in future studies. CFA and MIMIC models were evaluated with MPLUS7 ...
This suggests that the relatively small differences in age and BMI between our four donors did not account for major differences in these ASC features. We detected however differences in the strength of the adipogenic maturation at the level of single ASC isolated from the same depot. This was ...
Abbreviations CDC: Centers for Disease Control and Prevention; Corp.: Corporation; ESBL: Extended spectrum beta lactamases; HCAI: Healthcare associated infections; KBTH: Korle Bu Teaching Hospital; MDR: Multidrug resistant; MRSA: Methicillin resistant Staphylococcus aureus; SSI: Surgical site infections;...
6C). Although these results are suggestive of a mechanism to account for the observed increase in uncoupling activity, a more exhaustive series of studies is needed to definitively prove causality. Regardless of the mechanisms mediating proton leak, the overall effect of the blunted changes in kATP...
The Sp1 consensus binding sequence was purchased from Promega Corp. These double-stranded DNAs were end-labeled by T4 polynucleotide kinase and [γ-32P]ATP. Then, 0.1–0.2 ng of probes (∼2 × 105 cpm) were incubated with 5 μg of nuclear extract on ice for 20 min in a 20 μl ...
Mice were anesthetized with Ketamine (100 mg/kg) and xylazine (10 mg/kg), placed on digital X ray Film (Scan X) and exposed at 25kV for 15s using a Faxitron instrument (Model MX-20; Faxitron Corp. Buffalo, IL). Immunostaining Immunohistochemistry on paraffin-embedded sections and immuno...
Advantages Disadvantages • The loose layered structure can account for the volume expansion of SiNPs and prevent aggregation; • The electronic transport pathway can effectively promote carrier transfer; • Volumetric capacity should be • Layered structure can help maintain the stability and ...