Metro Grey Mica is the color name and its pretty bland in my opinion. I added the white roof and hood accents along with white wheels to help brighten up the car, which it did, but it was time for change. Oh yeah; white wheels and track spec brake pads don’t mix, just an FYI....
Martinez 3458 Building / Primer Piso Arquitectos Home-Office Pods AAND Sayana / Aaksen Responsible Aarchitecture NDT HH Home / Kiến Trúc NDT Studio One Eleven Unveils OC Great Park Community Centers 2 Single Rooms / Ji Architect Skybox House / Dick Clark + Associates Rehabilitation...
Grey: LOD but not LOQ is passed, black: LOQ is passed for the majority of replicates. See also Additional file 6: Figure S9 and Additional file 5: Figure S7 and S8 (effect of hydrolysis on analysed flavonoids). b Responses normalized with the respective deuterated internal standard. Several...
Over- and underrepresented categories present for the aptamer-based assay (SOMA) are highlighted by purple and grey arrows, respectively. When considering the subset of commonly measured features, the medians and standard deviations of the CV distributions remain similar to those observed in the non...
Agarose gel electrophoresis of PCR products amplified with specific primers for NS5 gene (266 pb). Lane 1: DNA marker (50 bp—Fermentas); lane 2: positive control; lane 3: negative control (RT-PCR) mix; lane 4: mock-infected cell; lane 5 to 8: DENV infected cell (MOI of 1) at ...
After isolation by PCR amplification from genomic DNA, extracted using GeneJET™ Genomic DNA Purification Kit (Fermentas) from a sheep brain tissue sample using 5’ CCGGAATTCCGGCGTACGATGGTGAAAAGCCACATAGGC 3’ and 5’ CTAGTCTAGACTAGGCCGGCCCTATCCTACTATGAGAAAAATG 3’ as primers, the open readin...
Black (P73) and grey (P94) circle borders indicate age-matched mice We then assessed the impact of BDNF stimulation on axonal transport in S OD1G93A mice (see Additional file 2: Table S1). In contrast to WT mice (e.g., Fig. 2), BDNF failed to enhance transport...
It was electropo- rated into G4 F1 hybrid ES cells and screening for positive clones with correct insertion was performed by PCR using a forward primer in the genomic ROSA26 locus 5′ of the targeting vector and a reverse primer in the 5′ region of the targeting vector (Additional file ...
Complementary DNA was created using 2 μg total RNA and amplified using oligodT primers and the RevertAid cDNA synthesis Kit (Fermentas, St. Leon-Rot, Germany). Negative controls (RT-) were carried out in the absence of reverse transcriptase to check for genomic contamination. Quantitative RT-...
(C57BL/6 × SJL) F1 hybrids. Mice were genotyped for the human SOD1 transgene using DNA extracted from ear notches and primers as previously described [5,6,7]. Female and male SOD1G93Amice display distinct patterns of disease, including differences in disease onset, progression and ...