Dr. Otto Octavius, The Spectacular Spider-Man, "The Invisible Hand""Ah, the Animal Kingdom offers many useful ideas!" Humans have always been fascinated by animals. Love them or hate them, they usually provoke a strong reaction in people, from the Jerkas
meaning that MHC-I–peptide binding prediction is an extremely imbalanced classification process. In fact, the imbalance among classes is a common issue in machine learning, and some methods have been developed to deal with it21. In MHCfovea, we used the ensemble strategy with downsampling22,23...
we reject the null hypothesis, meaning we assume that the two rows were not sampled from the same distribution. The quantity - log10(p-value(a|M))can be considered as a quantitative measure of strand bias and is called thestrand bias score...
In this work, we thoroughly examine the most common network motifs2,6with explicit delays and present an approachable, step-by-step view of the mathematical analysis (applying established DDE methods34,51) in order to make such delay equations easy to use for biologists and others. We show th...
The other residues in the fragment are not linked by hydrogen bonds between the backbone atoms, meaning that the regularity of the α- helix is broken to leave space for a small flexible loop characteristic of reentrant regions. The motif is highly specific to transmembrane proteins, with 23 ...
As regarding the biological meaning of homologous crossovers with subgenomic components, these mechanisms can serve as an efficient strategy that RNA viruses may use to diversify their RNA genomes and/or to guard the integrity of viral genome. It allows them to not only shuffle their genes so to...
Such is the case of domain III of SRA, where 45% of the G·U pairs are >95% conserved [23]; or NEAT1 where more than 20% of the G·U pairs are covariant base pairs [18], meaning that they cannot be replaced by canonical interactions. Specifically, the G·U wobble that closes ...
For example, the QGRS GGGACGTTCGGATTGGGTTACCAGGG would be considered (only for the purposes of the tetrad similarity computation) to have a tetrad length of 2.75 - as three of the four tracts have an adjacent extra guanine, meaning that a single mutation in the other tract would have ...
C. Epigenetic regulation of the neural transcriptome: the meaning of the marks. Nat Neurosci 13, 1313–8 (2010). Article CAS Google Scholar Cheng, C. et al. A statistical framework for modeling gene expression using chromatin features and application to modENCODE datasets. Genome Biol 12, ...
meaning that all nodes of a network are linked through relatively few intermediate steps, though they are only directly connected to a few, mainly neighboring, nodes1. Binary small-worldness is therefore the ratio of the clustering coefficient to the average path length, after both metrics are no...