I made this little nightstand inspired by The Sims 4 Pastel Pop Kit, created to be turned into custom content, and used in game. In the render I used higher resolution textures, but for the game I compressed them into 1024x1024, as the game requires. Poly count is 2074, which is sli...
Photo: flickr CC0 1,791 votes Agree or disagree? 40 Anansa Sims Photo: uploaded by LisaNelsonToton 1,455 votes Agree or disagree? See what is ranked #1 The Funniest Comedians To Ever Appear On 'Hot Ones' Vote 41 Maggie Brown Photo: Metaweb GNU Free Documentation License 1,498 votes ...
Born on May 25, 1973, in Murray, Kentucky, Sims had an early inclination towards modeling. Her ambitious spirit led her to drop out of Vanderbilt University in 1993 to pursue a modeling career. This bold move paid off when she was signed by NEXT Model Management, catapulting her into the...
Semantic-CC: Yongshuo Zhu, Lu Li, Keyan Chen, Chenyang Liu, Fugen Zhou, Zhenwei Shi. "Semantic-CC: Boosting Remote Sensing Image Change Captioning via Foundational Knowledge and Semantic Guidance." ArXiv (2024). [paper] [2024.07] Seismic Fault SAM: Ran Chen, Zeren Zhang, Jinwen Ma. "Seis...
Choko AT, Corbett EL, Stallard N, Maheswaran H, Lepine A, Johnson CC, et al. HIV self-testing alone or with additional interventions, including financial incentives, and linkage to care or prevention among male partners of antenatal care clinic attendees in Malawi: an adaptive multi-arm, multi...
Choko AT, Corbett EL, Stallard N, Maheswaran H, Lepine A, Johnson CC, et al. HIV self-testing alone or with additional interventions, including financial incentives, and linkage to care or prevention among male partners of antenatal care clinic attendees in Malawi: an adaptive multi-arm, multi...
The other beautiful new FastDates.com Calendar Kittens with the bikes are Maxim, Playboy and Penthouse centerfolds Karina Velez, Monica Sims and Riley Anne, together with Sophia Seban, Sara Horvath, and Taylor McKegney. This is a high quality 2022 Wall Calendar with 16-months starting with ...
15,815 changes: 6,400 additions & 9,415 deletions 15,815 OpenLap/OpenLAP Sims/OpenLAP_FEB_SN3_30kW_Michigan 2014.log Load diff Large diffs are not rendered by default. Binary file modified BIN +5.89 KB (100%) OpenLap/OpenLAP Sims/OpenLAP_FEB_SN3_30kW_Michigan 2014.mat Binary...
(Bio-Rad, USA) served as the detection instrument for conducting quantitative real-time PCR. The following primer sequences (5’-3’) were used: KCND2 (forward; AGTAATCAGCTGCAGTCCTCAGA, reverse; TGTTCGTCCACAAACTCGTGA), VSTM4 (forward; CTTTGCACACTCCTTCGACTC, reverse; GACGTAATGCCCTTGATCG...
Molly Sims Age: 51 33 votes Instagram: mollybsims Born: 05-25-1973 Dig Deeper 20 Celebrities Who Were Tri Deltas And Deeper 25 Celebrities Who Were on the Swim Team Also ranks #19 on The Most Gorgeous American Models 35 Beverly Johnson Age: 72 33 votes Instagram: iambeverlyjohnson Born...