HD has been used to treat viral infections for a thousand years in China. Previous studies have demonstrated that MIR2911 (0.06–0.18 pmol/day) in 1–3 ml HD significantly inhibits influenza virus replication in 20 g mouse2. In addition to the Pharmacopoeia of the People’s Republi...
Given the unique GC-enriched nucleotide composition of MIR2911 (GGCCGGGGGACGGACUGGGA) and after we analyzed the genome sequence of SARS-CoV-2, it is most likely that the virus genome contains MIR2911-binding sites and that MIR2911 can inhibit SARS-CoV-2 replication directly. In the present ...