Methods: Human HMC were divided into control group(NC group), high glucose group(30 mmol/L glucose), negative sequence(si-NC) group, KCNQ1OT1 small interfering RNA(si-KCNQ1OT1) group, si-KCNQ1OT1 simulated control sequence(mi R-NC) group, si-KCN...
Immunofluorescence (IF) was used to analyze the effect of GSK-3β inhibitor (CHIR99021) on β-catenin and CyclinD1 expressions levels in BMSCs. A total of 428 differentially expressed miRNAs were found between the NOR and MOD groups. KEGG analysis showed that the target genes were mostly ...
Additionally, miR-124-3p has been identified as an inhibitor of EGR1. Overexpression of miR-124-3p in hiPSC-CMs resulted in a lower rate of apoptosis in the IH/R group compared to the control groups. These findings may offer new targets and approaches for cardio-protection against IH/R ...
Conversely, the miR-124-3p inhibitor could increase the ability of tumor cell growth in culture (Figs. 2c, d; Fig. S2c, d). Cell wound scratch assay revealed that miR- 124-3p mimic notably inhibited NSCLC cell invasion, while transfection with miR-124-3p inhibitors showed the reverse...
miR-124-3p mimic or inhibitor oligo-RNAs (target sequence: UAAGGCACGCGGUGAAUGCC) were Expression of Fra-2 in glioma cells is associated with tumor migration, invasion, and growth Consistent with the previous reports indicating an upregulation of Fra-2 in other cancers, Fra-2 protein levels ...
Methods Glioma U87 cells were grouped into control, SM low, medium, and high concentration groups, and SM high concentration miR-124-3p inhibitor group (SM high miR-124-3p inhibitor group). CCK-8 was used to measure the proliferation rate of cells; Transwell assay was applied to assay the...
(M) in IAR20 cells transfected with the miR-124-3p-inhibitor.NEffect of Erastin on the viability of IAR20 cells transfected with the miR-124-3p inhibitor.OIAR20 cells were transfected with the NC-inhibitor and the miR-124-3p-inhibitor, respectively, and the levels of Lipid-ROS and Fe2+...
MiR-124-3p inhibitor reduced apoptosis induced by C. psittaci, increased the replication of C. psittaci, and inhibited PI3K/AKT activation, whereas miR-124-3p mimic produced opposite effects, and transfection with EIF3B siRNA reversed the effects of miR-124-3p inhibitor. Our findings suggest ...
Methods Glioma U87 cells were grouped into control, SM low, medium, and high concentration groups, and SM high concentration miR-124-3p inhibitor group (SM high miR-124-3p inhibitor group). CCK-8 was used to measure the proliferation rate of cells; Transwell assay was applied to assay the...
MiR-124-3p was overexpressed in vivo by intratracheal administration of miR-agomir, and PDE4B was expressed at low level in vivo by intratracheal administration of a PDE4B inhibitor. The mRNA expression level was detected by qRT-PCR, and the protein expression level was detected by Western ...