Open Location Code7QJ2FGCC+VH GeoNames ID6595104This page is based on GeoNames, Wikidata and Wikimedia Commons. We welcome you to please improve upon our open data sources. Thank you for your contributions. Edit This PlaceTong’an Guoxiao Satellite Map©...
Bradley University Campus Map Brown University Campus Map Butler University Campus Map Brigham Young University Campus Map California University of Pennsylvania Campus Map Cameron University Campus Map Campbell University Campus Map Campbellsville University Campus Map Cardinal Stritch University Campus Map Centra...
[50], cotton cytochrome P450 CYP78A5 monooxygenase (KLU), with forward sequence “GCTGATAGGCCAGTGAAGGA” and the reverse sequence “TCTTGAGCCTTTGCTTGGAT” [51], were profiled on the leaf tissues of Gh_A05G3286 (NLP5)-silenced plants, wild type (WT) and the positive controlled plants ...
Heart of the Campus University of Strathclyde CITIES, REGIONS & BUILT ENVIRONMENT| NATURE The Heart of the Campus Project encompasses Rottenrow Gardens and the surrounding streets of Rottenrow, Richmond Street and North Portland Street. The site has historic relevance as it is the location of the...
The locality lies at an elevation of 920 metres. The latitude is 12.7843888 while the longitude is 77.64185880000002. The upcoming IIM-B second campus is slated to come up in Jigani and several granite factories are also located here. Leading companies like Otis, HCL and Toyota are located ...
B6.Cg-Tg(Fev-cre)1Esd/J (ePet-cre mice; RRID:IMSR_JAX:012712) males and females, 8–16 weeks of age, were used in this study. ePet-cre Genotyping was complete using forward primer AAAATTTGCCTGCATTACCG, reverse primer ATTCTCCCACCGTCACG and an annealing temperature of 57 °C. ...
We examined the frequencies of different motifs of pSTRs by repeat length and found that adenine rich motifs accounted for most (78.9%) pSTRs with two to five repeats (see Additional file 7: Table S3). For hexanucleotide pSTRs, ACAGCC is the most abundant motif, followed by AAAAAC, AAAA...
Table 1. Primers used for the cloning of the Mnk1a and Mnk1b mutants MutantsNameSequence Mnk1a/b T2D2 209D214D5 5′-ATAACCGACCCAGAGCTGACCGACCCATGT-3′ 209D214D3 5′-ACATGGGTCGGTCAGCTCTGGGTCGGTTAT-3′ Mnk1a/b T2A2 209A214A5 5′-ATAACCGCACCAGAGCTGACCGCCCCATGT-3′ 209A214A3...
Vicinity Map I-10 Corridor Project EA 0C2500, PN 0800000040 07-LA-10 PM 44.9/48.3 08-SBd-10 PM 0.0/R37.0 May 2017 In Los Angeles and San Bernardino Counties On Route 10 between 0.4 Miles West of White Avenue Overcrossing and Live Oak Canyon Road Overcrossing Project Report ii I-10 ...
5′-ACCCACGACGATACAGATGCTG-3′ GAPDH Forward primer: 5′-ACAAGATGGTGAAGGTCGGTGTGA-3′ Reverse primer: 5′-AGCTTCCCATTCTCAGCCTTGACT-3′ The ratio of miR-26a versus U6 expression and the relative expression levels of MAPK6, MMP-2 and MMP-9 to GAPDH were determine...