Conserved protein domains were identified using MEME (Multiple Expectation Maximization for Motif Elicitation; http://meme.nbcr.net; [100]). As the selection of taxa can bias the identification of domains, we began by comparing a small set of deeply diverged taxa in order to avoid over-weighti...
it is necessary to compare the genomes of snakes to the genomes of several fully limbed reptiles and other vertebrates. Given the sparsity of genomes of reptiles with well-developed limbs, we sequenced and assembled the genome of the fully...
White lines correspond to participants belonging to group 1, and gray lines correspond to participants belonging to group 2. 2.2. Experimental Sessions The protocol comprised two sessions separated by a washout phase that lasted two to four weeks. In each session, patients underwent a pre- and ...
MEME is a more specialized codon-based method to detect episodic selection pressure. P values representing significance of positive selection for each site were calculated using LRT statistics. Additionally, as an alternative to FEL, Bayes Empirical Bayes (BEB) positive selection analysis [32] ...
The CRISPR/Cas9-positive lines were identified by PCR, then further genotyped for mutations using the primers (Fwd: ACATGGTTTCACTGTAAAGGGATCT and Rev: CTGGCCTGAAAGAAAAGCATCAAA) spanning the two sgRNAs target sequences by PCR and Sanger sequencing of ARF4-PCR products. 2.3. Characterization ...