in an induction bucket, the rank of the previous induced position is maintained. Whenever another position is induced, this previous rank is used to determine whether to mark the newly induced position as the beginning of a new rank group. All the logic to update the ranks and mark the begi...
LCSLongest-Common-Subsequence(algorithm) LCSLakeland Christian School(Lakeland, FL) LCSLogic Control System(various companies) LCSLocal Coordinate System LCSLast Comic Standing(TV series) LCSLaser Cataract Surgery(eyes) LCSLongest Common Subsequence ...
> LongestCommonSubStringseq1,seq2 TGGCGAGTATGG (7) > LongestCommonSubSequenceseq1,seq2 AAGGCCGCGCAGCTGGCGATTGGTCAGCCCTGGAAGGTGGGCTCTCCCCTGCTCGACCCGGGTCCGCCCGCGGACCCA (8) See Also string StringTools StringTools[CommonPrefix] StringTools[CommonSuffix] StringTools[Leven...
LBLogic Block LBLocal Battery LBLutheran Brotherhood LBLiquid Broth LBLeaky Bucket(traffic policing algorithms) LBLoveboat LBLocal Buckling(structural element) LBLanding Beach LBBurst Length(Transmission Channel Parameter) LBLoad Buffer LBLine Booster ...
LongestCommonSubSequence(s1,s2) Parameters s1 - Maple string s2 - Maple string Description • Asubstringof a stringSis a contiguous sequence of the characters appearing inS. The empty string is a substring of every string. Asubsequenceof a stringSis a sequence of characters fromS, which may ...