Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) served as an internal control for normalization. The primer sequences used were as follows: GAPDH sense: 5′-GAGGACCTGACCTGCCGTCT-3′. GAPDH-antisense: 5′-GGAGGAGTGGGTGTCGCTGT-3′. PD-L1-sense: 5′- AGCGGCAAAATGAGCAGTAGA − 3′. PD-...
We have demonstrated in this study that anlotinib can inhibit PD-L1 expression on VECs so as to break through the “immune tolerance barrier”, promote CD8+T cells infiltration, improve the balance of CD8/FoxP3. This work provides new insights into the effects of antiangiogenic therapy on tumo...
A paradigm shift in cancer immunotherapy: from enhancement to normalization. Cell 175, 313–326 (2018). Article CAS PubMed PubMed Central Google Scholar Boussiotis, V. A. Molecular and biochemical aspects of the PD-1 checkpoint pathway. N. Engl. J. Med. 375, 1767–1778 (2016). Article...
Normalization was done using DCs stimulated with live cancer cells. Fold-change values derived from above antibody array for different immunological factors, cytokines or chemokines per treatment condition were used to run a GSEA analysis using WebGestalt (WEB-based Gene SeT AnaLysis Toolkit), which ...
This confirms that the interactions detected by the analysis before normalization were spurious and due to the fact that the effect of genotype was not additive but multiplicative. The absence of effects of genotype (alone or in combination with stimulus, day or time) indicates that both the ...
Homographies are represented as 3x3 nonsin- gular homogeneous matrices (that is, only the ratio of the elements is significant, or put another way, homographies are equivalent up to normalization). Homographies are a powerful tool for stabilization, but the nonlinearity po...
Gapdh was used as a reference gene for the normalization of the data. Each amplification reaction occurred in the standard cycling in the following cycles: 10 min at 95 °C and a further 40 cycles with 15 s at 95 °C and 1 min at 60 °C. Relative quantification was calculated by the...
Samples were denatured with a loading buffer and analyzed with sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE) by volume normalization for further Western blotting analysis with exosomal marker protein antibodies, anti-CD9 (13403S, CST, USA), anti-CD63 (ab59479, abcam, USA),...
where (17) and (18) carry out the dualL1normalization corresponding to the constraint in (14), ensuring the one to one mapping between samples in consecutive sets. We can prove that $$ g({\mathbf{w}}_{{\varvec{\vartheta}_{1} }}^{1} (\tau + 1), \ldots ,{\mathbf{w}}_{{...
A paradigm shift in cancer immunotherapy: from enhancement to normalization. Cell 175, 313–326 (2018). Article CAS PubMed PubMed Central Google Scholar Boussiotis, V. A. Molecular and biochemical aspects of the PD-1 checkpoint pathway. N. Engl. J. Med. 375, 1767–1778 (2016). Article...