We also examined the associations between plasma zinc and dietary intake of zinc or phytate, iron status, plasma concentrations of C-reactive protein, albumin, and hemoglobin. Food intake was estimated by 2 24-h dietary recalls and 1 FFQ for each woman. The plasma zinc concentration was (mean...
HBA-a1 (NC_000077.6) targeting site for guide RNAs were identified using the online ZiFiT (Zinc Finger Targeter) software version 4.2 (http://zifit.partners.org)32. The sgRNA target site 5′- GGAAAGTAGGTCTTGGTGGT −3′ and its recommended 22 nucleotide long oligos(oligo 1: 5′-TAGGAAA...
In 5- to 15-year-old children (n281), height, weight, haemoglobin (Hb), whole blood zinc protoporphyrin (ZPP), erythrocyte glutathione reductase activity coefficient (EGRAC), serum retinol, C-reactive protein (CRP) and prevalence ofPlasmodiumspp. (asymptomatic malaria) andSchistosoma haematobium...
Always COMBINE this with zinc, as zinc is the key here. You can use the tea leafs for a second brew, but you will not get the EGCG with the second brew, so just drink it for pleasure :-) (and to use the green tea to the max, as there will be other valuable substances in the...
Logistic regression was used to examine the predictors of zinc deficiency among the participants. The overall zinc deficiency in children was 22.9%, while it was higher in non-pregnant women (24.7%). The prevalence of anemia among zinc-deficient children was higher (21.3%) than the zinc non-...
Women of reproductive age in developing countries are highly vulnerable to nutritional deficiencies, including that of zinc. To estimate the prevalence of zinc deficiency and to identify important dietary sources of zinc, we undertook a cross-sectional survey in 500 nonpregnant Nepalese women and ...
BACKGROUND: Spermatogonia are highly tolerant to reactive oxygen species (ROS) attack while advanced-stage germ cells such as spermatozoa are much more susceptible, but the precise reason for this variation in ROS tolerance remains unknown. METHODOLOGY/PRINCIPAL FINDINGS: Using the Japanese eel testicul...
Zinc 1. Introduction Saline–alkali soil is one of the main environmental factors affecting crop productivity, especially in arid and semi-arid areas (Zhang, 2008, Zhang, 2020a, Zhang, 2020b). Due to global industrialization, unplanned urbanization, climate change, and different types of soil de...
et al. The disulfide bond, but not zinc or dimerization, controls initiation and seeded growth in amyotrophic lateral sclerosis-linked Cu,Zn superoxide dismutase (SOD1) fibrillation. J Biol Chem 290, 30624–30636, doi: 10.1074/jbc. M115.666503 (2015). 27. Solsona, C. et al. Altered thiol...
(Supplementary Fig.1). The most common domains identified were binuclear zinc cluster (n = 192 (PFAM00172) and fungal-specific transcription domains (n = 195 (PFAM04052 and 11951); Supplementary Fig.1). This is consistent with previous reports that describe domains of transcription ...