The following primers were used for genotyping: for ncx-9(gk773708), ncx-9(gk773708)F (gtctcctcttttaacttcatggctccaa) and ncx-9(gk773708)R (tgactactctggcgttcatagttttctgc) to identify a G to A base pair change; for ncx-9(gk234237), ncx-9(gk234237)F (ccgttccgatggaatggaat) ...
Particulate material comprising the detrital remains of terrestrial plants and macrophytes is a substantial source of organic matter to estuaries and therefore has the potential to support the energy demands of the pelagic aquatic food web. Despite the prevalence of macrophytic or terrestrial particulate...
DAT In8 VNTR R 5′-TCATCCCAGGGACATCTGCTA-3′ Statistical Analysis Including Tests for Association to AEI and Clinical Association Studies Genetic data were analyzed with SPSS version 17.0 (SPSS Inc. Chicago, IL and HelixTree (Golden Helix), providing genetic association, haplotype estimation and...
The evolutionary model of PROTCATBLOSUM62 and bootstrap convergence criterion were employed. The phylogenetic tree of species with the best maximum likelihood score was retained and labeled with bootstrap support values. Divergence time along the phylogenetic tree of species was estimated using r8s120 ...
The phylogenetic tree of species was built via raxmlHPC-PTHREADS-AVX in the standard toolkit of RAxML119(version 8.2.12) based on the supermatrix constructed in the previous step. The evolutionary model of PROTCATBLOSUM62 and bootstrap convergence criterion were employed. The phylogenetic tree of...
The epicardium, a mesothelial cell tissue that encompasses vertebrate hearts, supports heart regeneration after injury through paracrine effects and as a source of multipotent progenitors. However, the progenitor state in the adult epicardium has yet to