The following primers were used for genotyping: for ncx-9(gk773708), ncx-9(gk773708)F (gtctcctcttttaacttcatggctccaa) and ncx-9(gk773708)R (tgactactctggcgttcatagttttctgc) to identify a G to A base pair change; for ncx-9(gk234237), ncx-9(gk234237)F (ccgttccgatggaatggaat) ...
Particulate material comprising the detrital remains of terrestrial plants and macrophytes is a substantial source of organic matter to estuaries and therefore has the potential to support the energy demands of the pelagic aquatic food web. Despite the prevalence of macrophytic or terrestrial particulate...
Amynthas corticis(Kinberg, 1867), is in the Megascolecidae, which has a primarily Asian-Australasian distribution. With physical dispersal,A. corticishas become a cosmopolitan invasive species with an east Asian origin. It has been suggested that the invasive ability ofA. corticisis due to it...
The evolutionary model of PROTCATBLOSUM62 and bootstrap convergence criterion were employed. The phylogenetic tree of species with the best maximum likelihood score was retained and labeled with bootstrap support values. Divergence time along the phylogenetic tree of species was estimated using r8s120 ...