a complex that involves the glucose-related protein of 94 kDa or Grp94 [5,6]. This chaperone controls the late folding steps and the sorting of the active enzyme toward secretion [7]. Once in the trans-Golgi network and after completion of glycosylation [8,9], the complex is usually ...
XBP1s CTGAGTCCGAATCAGGTGCAG ATCCATGGGGAGATGTTCTGG PSMD6 AGCCCTAGTAGAGGTTGGCA AGGAGCCATGTAGGAAGGC, GAPDH CAACGGATTTGGTCGTATTG GATGACAAGCTTCCCGTTCT Immuno-gold labeling in transmission electron microscopy HeLa cells were seeded on 3 mm carbon-coated Sapphire disks (Wohlwend GmbH, Switzerland...
We also found that the enzyme gamma-glutamyltransferase-5 (GGT5), which was highly expressed by follicular dendritic cells, metabolized GGG to a form that did not activate the receptor. Overexpression of GGT5 disrupted the ability of P2RY8 to promote B cell confinement to germinal centres, ...
According to PSM, for liver enzyme GGT a total of 3664 participants were analyzed. The results of multivariate CPHM showed there is a relationship between participants with high level of GGT and had a higher risk of HTN (HR 1.34; 95% CI: 1.11–1.63). After PSM analysis, the effect of ...
Mouse KAT3 is a major glutamine transaminase in the kidney although it was named a liver type transaminase. General significance Our data highlights KAT3 as a key enzyme for studying the nephrotoxic mechanism of some xenobiotics and the formation of chemopreventive compounds in the mouse kidney. ...
Canis lupus familiaris Hyal2 (cHyal2) sequence (GenBank XM_541876) was amplified with primers cHyal2-F (ATG TGG GCA GGC CTG GGC CC) and cHyal2-R (CTA TGA AGT CCA GGT GAG CAC CAG G) from canine Cf2Th cell-derived cDNA. All amplified receptor sequences were subsequently inserted ...
Characterization of the extracellular gamma-glutamyl transpeptidases, GGT1 and GGT2, in Arabidopsis. 纬-Glutamyl transpeptidase (GGT) is the only enzyme known that can cleave the 纬-peptide bond between glutamate and cysteine in glutathione, and is therefo... N Ohkama-Ohtsu,S Radwan,A Peterson...
A minimum of 10,000 events was acquired each time. Enzyme-linked Immunosorbent Assay (ELISA) Cytokine concentrations were determined in lung leukocyte-conditioned medium using commercially available ELISA kits for rat IL-1β and IL-6 (R&D Systems, Minneapolis, MN, USA), and TNF (eBioscience ...
Here, in diffuse large B-cell lymphoma (DLBCL), serum metabolomic analysis revealed that oncogenic MYC could induce aberrant choline metabolism by transcriptionally activating the key enzyme phosphate cytidylyltransferase 1 choline-α (PCYT1A). In B-lymphoma cells, as a consequence of PCYT1A up...
Definitive haematopoietic stem and progenitor cells (HSPCs) generate erythroid, lymphoid and myeloid lineages. HSPCs are produced in the embryo via transdifferentiation of haemogenic endothelial cells in the aorta–gonad–mesonephros (AGM). HSPCs in the