3DGS GeneralizationGGRt: Towards Generalizable 3D Gaussians without Pose Priors in Real-Time Hao Li, Yuanyuan Gao, Dingwen Zhang, Chenming Wu, Yalun Dai, Chen Zhao, Haocheng Feng, Errui Ding, Jingdong Wang, Junwei Han arXiv preprint, 15 Mar 2024 [arXiv] [Project]...
I’m taking the sites in preference order – not size. PokerStars are still much bigger than the other sites. You’ll find GG then Party come next in terms of traffic, with 888 not too far behind. iPoker sites are not cutting it any more (barely any promotions, declining traffic), th...
Join the official Unblocked Sites discord server! https://discord.gg/rcpC9VfE The original Unblocked Sites repository :D This is your go-to place for unblocked game sites! I'd also appreciate a star :D - GitHub - TrickJoker312/Unblocked-Sites: Join th
gg.check-tl-ver-116-3.com, gi.check-tl-ver-116-3.com, sgh1s3.check-tl-ver-116-1.com, oa.check-tl-ver-116-1.com, ob.check-tl-ver-116-1.com, oc.check-tl-ver-116-1.com, od.check-tl-ver-116-1.com, oe.check-tl-ver-116-1.com, of.check-tl-ver-116-1.com, og.check...
(Rad18C28Fs: 50-atgttga aatactcgaagaaaattccacaccgcagcaaatc-30; Rad18C28Fas: 50-gatttgctgcggtgtggaattt tcttcgagtatttcaacat-30; Rad18C207Fs: 50-aagttactaaagtggattgtcctgttttcggggttaacattc-30; Rad18C207Fas: 50-gaatgttaaccccgaaaacaggacaatccactttagtaactt-30: Rad18SAP*s: 50-aaaagagcatgg...
To investigate the noncovalent interactome of ISG15 and cytosolic sensors for ISG15 modification, we used Virotrap, a recently developed MS-based approach to map protein–protein interactions42. Briefly, the sequence of mature ISG15 (ending on -LRLRGG) was genetically fused via its N-terminus to...
sg3.1-pcr-F GGCAGCATTGTCTCCAACCT sg3.1-pcr-R CCCCTACCTTCTTGCTCTGT sg6.4 (6.6)-pcr-F ACCGACTCTTCCCACCTCA sg6.4 (6.6)-pcr-R GCATTGTAAACAGGCATTAGGA Supplementary Table 4. Gene List of Common METTL3 Targets (m6A-seq) TranscriptGene symbolTranscriptGene symbol ENST00000535787 ACVR2A ENST0000...
Wang Y, Ostlund C, Choi JC, Swayne TC, Gundersen GG, Worman HJ (2012) Blocking farnesylation of the prelamin A variant in Hutchinson-Gilford progeria syndrome alters the distribution of A-type lamins. Nucleus 3:452–462 Article PubMed PubMed Central Google Scholar Worman HJ, Ostlund C...
You are welcome to join the RWKV discord https://discord.gg/bDSBUMeFpc to build upon it. We have plenty of potential compute (A100 40Gs) now (thanks to Stability and EleutherAI), so if you have interesting ideas I can run them. RWKV [loss vs token position] for 10000 ctx4k+ docum...
plain: http://m6rqq6kocsyugo2laitup5nn32bwm3lh677chuodjfmggczoafzwfcad.onion/ proof: link check: ✅✅✅✅✅✅✅✅✅✅✅✅✅✅ Debian Home 🔧 link: http://sejnfjrq6szgca7v.onion/ plain: http://sejnfjrq6szgca7v.onion/ proof: link check: ✅✅🆘✅✅...