animals. To verify the suitability of the DNA samples for amplification, 300 ng of each sample DNA were tested for the amplification of the mouse globin gene, using specific primers (5′CACCTGACTGATGCTGAGM3′ and 5′ATTACCCATGATAGCAGAGG3′). All the samples were suitable for the ...
Hs code 01011100 Product tags nima,live horse,reed,bred Product description LIVE HORSES:PURE BRED BREEDING ANIMALS (KG NO) Registered users can check itLogin nowRegister for free Products Products Transactions Per Detail bred 1 100% > live horse 1 100% > nima 1 100% > reed 1 100...
Hs code 01011010 Product tags nima,live horse,reed,bred Product description LIVE HORSES:PURE BRED BREEDING ANIMALS ( KG NO) Registered users can check itLogin nowRegister for free Products Products Transactions Per Detail bred 1 100% > live horse 1 100% > nima 1 100% > reed 1 10...