How to determine the amino acid sequence from the carboxy terminus of the protein or peptidePURPOSE: To determine amino acid sequence from a C end of protein without using enzyme by making free amino acid into acetyl and extracting and identifying oxazolon derivative from amino acid of acetyl...
1. How does an amino acid's sequence in a protein affect its shape and its function? Use types of molecular bonding and structure of individual amino acids. 2. Name two factors that can affect the shape of a protein. How do amino acids attach to tRNA?
The sequence is' open'when read in an appropriate frame, which is to sayWalter M. FitchUniversity Science BooksDoolittle R. F. (1986) Of Urfs and Orfs, a Primer on How to Analyze Derived Amino Acid Sequences. University Science Books, Mill Valley, California....
How can I use this function to find start and stop codons in each sequence? (without frame shifting) I have a file (mydata.txt) that contains many exon sequences with fasta format. I want to find start ('atg') and stop ('taa','tga','tag') codons for each DNA sequence (consideri...
The process of digestion in humans follows an amazingly well organized sequence. The various parts and organs found along the digestive tract play different but important roles. Any disruption in this normal process can cause abdominal pain. See a step by step account of how this marvelous ...
How many different proteins, each with a unique amino acid sequence, can be constructed with a length of 8 amino acids?Amino Acid Sequence :An amino acid sequence is the specific, linear arrangement of amino acids of a peptide or protein. In nat...
Explain how Biuret's reaction with amino acids as compared to other protein substances. Which of the following is NOT a way in which amino acid structure and sequence might affect the properties of a protein? a. Amino acid side chains form peptide bonds with each other, causi...
In this blog, we draw on our experience as antibody experts to explain why this might happen, and provide you with the tools to determine cross-reactivity in your own experiments.What is cross-reactivity? An antibody has a specific amino acid sequence (the Fab region) that dictates its ...
Step by step video, text & image solution for How many amino acid can be polymerised by given m-RNA sequence during translation in a bacteria ? 5' AUGUCCACGAUAGACUGAUAA3' by Biology experts to help you in doubts & scoring excellent marks in Class 12 exams.Updated on:21/07/2023Class...
Related to this Question How can you determine the sequence of DNA, RNA, and protein? How does RNA know how to read the DNA? How do you know what DNA strand the mRNA will use as a template? How do you determine an amino acid sequence from RNA?