A GGT blood test is normally ordered to assess for liver injury or biliary obstruction. Both of these conditions will usually result in an elevated GGT level. Gamma glutamyl transferase is an enzyme that is mainly produced by the pancreas, heart and liver. Levels can become high if any of t...
When you liver is damaged, enzymes from the liver leak into the bloodstream which then can be detected by a simple blood test. Is there a chance that you have hepatitis? I know that hepatitis can cause problems to the liver that then elevate your GGT. Also liver tumors are very ...
GGT, an abbreviation for gamma-glutamyl transferase, is a liver enzyme. It is also known as a gamma-glutamyl transpeptidase (GGTP or g-GTP). A blood test can determine your GGT level and is used to detect damage to the liver. GGT levels are increased in persons with diseases that cause...
There also are other liver enzymes such as, lactate dehydrogenase (LDH), glutamate dehydrogenase, and gamma-glutamyltranspeptidase (GGT), which are less routinely measured clinically. How Long Will It Take to Get the Results (Interpretation) of Your Liver Blood Tests? The ALT and AST levels are...
The sequences of the β-actin primers were as follows: 5′ GATGATATCGCCGCGCTCGT and 5′ GGTCATCTTCTCGCGGTTGG. RNA samples were tested for β-actin sequences to verify that each sample was intact and capable of reverse transcription and PCR amplification. The sequences of the globin mRNA ...
Sargassum serratifolium (C. Agardh) C.Agardh, a marine brown alga, has been consumed as a food and traditional medicine in Asia. A previous study showed that the meroterpenoid-rich fraction of an ethanolic extract of S. serratifolium (MES) induced adipos
Obesity is often accompanied by dyslipidemia, high blood glucose, hypertension, atherosclerosis, and myocardial dysfunction. Selenate is a vital antioxidant in the cardiovascular system. The beneficial effects of selenate on obesity-associated cardiac dysfunction and potential molecular mechanism were identifi...
It can cause serious infections like ventilator associated pneumonia (VAP), skin and soft tissue infection, wound infection, secondary meningitis, blood infection, etc2, 3. Since A. baumannii is commonly resistant to clinically available antimicrobial agents, including β-lactams, aminoglycosides and ...
An alignment performed with Biology Workbench 3.2 at the San Diego Supercomputer Center (SDSC) [16] is shown in Fig. 1. The primers for CHD-Z- and CHD-W-specific PCR of S. c. hoya were redesigned as follows: CHD-W-F: 5-GAGATGGAGTCACTATCAGATCC-3, CHD-W-R: 5-GGTTTTCACACATGGCACA...
were visualised in a network (Fig.5b). Some of these genes, includingEPAS1,MAFKandGNPAT, are expressed at high levels in artery, lung and heart tissues, while others, such asPTPRCand HLA-related genes, are expressed at high levels in the blood, and many of the genes, such asTMEM247,...