blood donation is known to reduce iron overload, whereas alcohol consumption increases it.29,30 In France, the population of Brittany shows high prevalence of hereditary hemochromatosis; the blood center of Brest has been involved in venesection treatment since the early 1970s and HFE gene test ...
The gene test is most useful in screening adult blood relatives of an identifiedproband. Screening blood relatives is crucial, because 25% of siblings and 5% of children of a proband will have HH.HFEgene testing should replace more expensive HLA typing previously used to screen siblings. In add...
Frequency and biochemical expression of C282Y/H63D hemochromatosis (HFE) gene mutations in the healthy adult population in Italy. J Hepatol 2001;34:523-528.Agah MR, Zafarghandi M, Motahari Z, et al. Frequency and biochemical expression of hemochromatosis (HFE) gene mutations in 1029 blood ...
HFE mutations analysis in 711 hemochromatosis probands: evidence for S65C implication in mild form of hemochromatosis. Blood 1999;93:2502–2505. 39. Barton JC, Sawada-Hirai R, Rothenberg BE, Acton RT. Two novel missense mu- tations of the HFE gene (I105T and G93R) and identification of ...
DNA was isolated from tail biopsies according to DNeasy blood and tissue kit (QIAGEN, CA). To amplify HFE gene including the H67D variant PCR analysis was conducted using a forward primer (5′AGGACTCACTCTCTGGCAGCAGGAGGTAACCA3′) and a reverse primer (5′TTTCTTTTACAAAGCTATATCCCCAGGGT3′)...
homeostatic iron regulator gene HLA: human leukocyte antigen LDL: low-density lipoprotein MetS: metabolic syndrome NAFLD: non-alcoholic fatty liver disease QFe: quantity of iron removed by phlebotomy to achieve iron depletion SD: standard deviation SE: standard error SF: serum ferritin ...
Frequencies of the HFE alleles were calculated by gene counting. Hardy-Weinberg equilibrium was tested before proceeding to the analysis. Statistical analysis of mutation prevalence in case and control groups was performed by using two-tailed Fisher's exact test. The proportions of patients with breas...
Figure 1. Analysis of Hfe gene expression. Hfe expression was analyzed in various organs and in isolated cell fractions from spleen and liver. (A) mRNA was isolated from various organs, as indicated, and was used to synthesize cDNA. Hfe mRNA expression was quantified by qRT-PCR and normalized...
A novel MHC class I-like gene is mutated in patients with hereditary haemochromatosis Nat Genet, 13 (1996), pp. 399-408 View in ScopusGoogle Scholar 4 Beutler E, Gelbart T, West C, et al. Mutation analysis in hereditary hemochromatosis Blood Cells Mol Dis, 22 (1996), pp. 187-194 ...
Methods:Ninety samples, previously screened by direct sequencing, and 27 controls were used. The analysis were performed on the Rotor Gene Q, using the commercial HRM mix containing the Eva Green dye (Qiagen). Specific primers allowed the amplification of the regions of interest in theHFEgene....