Moreover, urine specimens testing positive in VERSANT assay were retested by in-house PCR assays, used as confirmatory tests. VERSANT庐 CT/GC DNA 1.0 Assay performed with 99.4% and 99.2% of specificity for GC and CT detection, respectively, whereas sensitivity was 100% both for CT and GC. ...
GC content in PCR When considering a fragment of DNA, for primer design or cloning of an entire gene, it is important to note GC content given the higher amount of energy required to break the three hydrogen bonds. PCR is a widely utilized tool where GC content is of high importance. DN...
Moreover, urine specimens testing positive in VERSANT assay were retested by in-house PCR assays, used as confirmatory tests. VERSANT CT/GC DNA 1.0 Assay performed with 99.4% and 99.2% of specificity for GC and CT detection, respectively, whereas sensitivity was 100% both for CT and GC. ...
In this study Versant CT/GC DNA 1.0 (Siemens) performances have been evaluated by testing ocular, rectal or pharyngeal secretions collected by Siemens collection devices.Methods Study group. A prospective study was performed with 7 newborns with conjunctivitis, and 183 subjects attending the STD ...
Samples were tested by VERSANT CT/GC DNA 1.0 Assay (Siemens Healthcare Diagnostics Inc., Tarrytown, USA), a multiplex Real-Time PCR assay for simultaneous CT/GC detection. A total of three specimens were collected from each patient, respectively: one urine sample for...
Genotyping of the animals was performed by PCR analysis of ear puncture DNA using the following primers: for detection of the R26-CAG-cGi500(L1) and R26-CAG-cGi500(L2) allele, BB01 (CTCTGCTGCCTCCTGGCTTCT), BB02 (CGAGGCGGATCACAAGCAATA), and BB03 (TCAATGGGCGGGGGTCGTT), which amplify...
Article The Effect of Steel Trusses on the Mechanical Performance of Laminbautieldd iPnregcsast Slabs GAonrtgicflee ng Xin 1, Guanxu Long 1, Jizhi Zhao 2,* and Zejun Zhang 1 The Effect of Steel Trusses on the Mechanical...
DNA can be eluted from the card with simple processes instead of numerous purification procedures for downstream real-time PCR amplification and aetiology detection. This preliminary evaluation shows the potential use of FTA Card for rectal specimen collection and PCR testing, and may also provide a ...