Michele Stodart ... musician: bass guitarist, Jack's band Marcus Tamkin ... music department James A. Taylor ... vocal coach Chris Vatalaro ... musician: drums Tim Weller ... musician: drums Lewis Wright ... musician: drummer, Michael Kiwanuka's band Warren Zielinski ... music...
Black Cross Dart Player Adrian Derrick-Palmer ... Pro Darts Player (rumored) Bobby George ... Referee-TV Studio Triana Terry ... PA Rayner Bourton ... Godfrey Tom Cawte ... Carlyle Benjayx Murphy ... Brixton Market Trader Brittany Rohn ... Bobby Natasha Jenssen ....
Experimental set-up and virtual walking task (a) The set-up consisted of an HMD, two HTC Vive trackers (placed on the participant’s pelvis and the walker), an IMU (placed on the participant’s pelvis), a balance board, and the walker. Participants’ movements were tracked (left) an...
Random 20-mer libraries were generated with 20 random N bases with Alexafluor 647 conjugated to the 3′ end from IDT. Random 6-mer libraries were generated with 6 random N bases with Alexafluor 647 conjugated to the 3′ end from IDT.dArt4probe /5Alex647N/TTAATCATAATCGTATTGGG was synthe...
The main goal of this platform is that employees can create or join physical activity and relaxation groups, such as playing on a dartboard, walking during lunch hours, engaging in physical exercise and taking part in a book club. Furthermore, the employees will be able to find information ...
(DART), New York University Langone Medical Center, New York, NY 10016, USA; alireza.khodadadi-jamayran@nyumc.org 6 Medical Diagnostic Center, Yaoundé BP 15810, Cameroon; jmeli_cm@yahoo.fr 7 Chantal Biya International Reference Center for Research on HIV/AIDS Prevention and Management, Messa...
Summersgill B, Goker H, Weber-Hall S, Huddart R, Horwich A, Shipley J: Molecular cytogenetic analysis of adult testicular germ cell tumours and identification of regions of consensus copy number change. Br J Cancer. 1998, 77 (2): 305-313. Article CAS PubMed Central PubMed Google Scholar...
Board Member Georgia Employers' Association Dave and the entire Team at DART Direct Mail do a great job supporting us with all facets of our Direct Mail process. They are very responsive and helpful and continue to test and share ways to increase our DM response rates ...
Board Member Georgia Employers' Association Dave and the entire Team at DART Direct Mail do a great job supporting us with all facets of our Direct Mail process. They are very responsive and helpful and continue to test and share ways to increase our DM response rates ...
(unlike other UI locations that are restricted to and are part of other modules). This powerful element provides you with a blank canvas, to create, customize and optimize your users stack experience. Examples of this location in action can be viewed through Contentstacks Workflow Board or ...