RNA, unlike DNA, is single-stranded and uses the nucleotide base uracil instead of thymine. One specific form of RNA, called mRNA for being the 'messenger' RNA, carries the information from the DNA out of the nucleus and into the cytoplasm of a cell. The DNA is like the goods stored ...
During embryonic development, epithelial cell blocks called somites are periodically formed according to the segmentation clock, becoming the foundation for the segmental pattern of the vertebral column. The process of somitogenesis has recently been recapitulated with murine and human pluripotent stem cells...
The mammalian epigenome contains thousands of heterochromatin nanodomains (HNDs) marked by di- and trimethylation of histone H3 at lysine 9 (H3K9me2/3), which have a typical size of 3–10 nucleosomes. However, what governs HND location and extension is o
For in situ hybridization experiments, DIG-labeled (Roche) antisense RNA was transcribed from a linearized fragment using DIG-labeled dNTPs. Four rounds of in situ hybridization experiments were performed. In total, five male anal fins (plus two female anal fins) were studied from P. sp. '...
RNA can hybridize to double-stranded DNA in the presence of 70% formamide by displacing the identical DNA strand. The resulting structure, called an R-loop, is formed in formamide probably because of the greater thermodynamic stability of the RNA· DNA hybrid when it is near the denaturation ...
This human DNA fragment is therefore unspecifically functional in yeast, indicating that other sequence elements than the human polyadenylation signal, AATAAA, are necessary for 3′-end formation. 展开 关键词: Polyadenylation RNA 3′-end formation Transcription termination Yeast ...
AMPKα2, an α2 subunit of AMPK, is encoded by PRKAA2, and functions as the catalytic core of AMPK. However, the role of AMPKα2 in the LIHC tumor immune environment is unclear. Methods RNA-seq data were obtained from the Cancer Genome Atlas and Genotype-Tissue Expression databases. ...
magna ase (Dam-ase) were amplified by PCR on cDNA synthesized from RNA extracted from embryos of a mixture of embryonic stages. We constructed the following specific primers based on D. pulex sequences (wFleaBase): Dam-pros forward: GAAGTTGACATCGGGGAAGA, reverse: AACAACACGGAACTGGAAGG; Dam...
The error-free and efficient repair of DNA double-stranded breaks (DSBs) is extremely important for cell survival. RNA has been implicated in the resolution of DNA damage but the mechanism remains poorly understood. Here, we show that miRNA biogenesis enzymes, Drosha and Dicer, control the recru...
Our current knowledge of trichome development is largely derived fromArabidopsistrichome, a type of non-glandular unicellular trichome. Important genes that regulate trichome initiation, patterning and branching, as well as the associated and cellular processes have been well characterised using theArabidopsi...