Garden Tools Set of 3pc Floral Design Clippers Trowel Weeding Fork Plant Gardening Trowel, Cultivator, Pruning Shear Features: The Garden tool set is in good quanlity. You can use it to make your garden much more beautiful and...
-The plastic flower rod with compact design makes it easy to store, which will not take up too much space. -The stem for wedding is able to develop your DIY making skills and improve your hands-on ability. 50 x 25cm Artificial Flower Stems 50 x 17cm Artificial Flower StemsSorry...
Design Pattern: Flowers Plants,Featuring intricate patterns of plants and flowers, this kit is ideal for beginners and seasoned crafters alike. Great Service: Customer Support,Enjoy peace of mind with our dedicated customer service, ready to assist with any inquiries. ...
Ceramic Flower Modeling 4 Pieces Metal Ball Stylus Dotting Embossing Pattern Design Sculpting Tool Bl14399 US$0.80-0.96 100 Pieces (MOQ) 3 Tips in 1 Handle Changeable Heads Craft Embossing Tool for Paper Craft (TCE-3) US$0.45-0.73 3,000 Pieces (MOQ) Wood Textured Rolling Pin Chri...
New Design Needle Storage bottle Cylinder stainless steel needle case $3.87 - $4.46 Min. order: 50 pieces Bronze metal long nail special thimble&new type vintage sewing thimble $0.70 - $0.90 Min. order: 20 pieces RTS 30pcs Crochet Hook Tool Set Knit Needles For Hand Knitting Needles Tools ...
The pink roses are cut fromEcho Park“Style Essentials” Lt. Pink pattern paper. This was sort of my design, edited from my friendDebbie’scutting file. I took the shapes she provided and welded them in the center so they would be easier to assemble. I glued four individual petals for ...
This card was so quick to make using the layers from the kit, building up the card to create something so pretty. Step 1: Now Watch the Tutorial
(2016). The Breaking-Cas software (Oliveros et al., 2016) was used to design the single-guide RNA (sgRNA) target sequences within the coding region of SlCRCa (GTATCCAACAACTTCTTGCA) and SlCRCb (GTATCCATTAGCCTCTTGTA). Primers used in the generation of RNAi and CRISPR/Cas9 constructs ...
OEM Acceptable: Size/Design/Packing OEM is accepted MOQ: 300 Sets Sample and Freight: Sample can be provided free, but freight cost need to be bear by customer Packing: OPP Bag/PVC bag/ NonwovenBag Set Detail: duvet cover+bedsheet + pillow ca...
is a quintessential tool for creating stunning flower crowns and gorilla tags. Its design is inspired by the Japanese frog cartoon, adding a touch of whimsy to the traditional art of Ikebana. The needle quantity varies with the size, ensuring that you have the perfect number of pins to secure...