Using 5′-biotin-labeled forward primer (AGTAACGCCAGCCTAACATATAA), the region of ABCC8 containing the RV was immobilized to streptavidin beads. Nuclear fraction (100 μg) was extracted from HCT-116 cells using NE-PER™ Nuclear and Cytoplasmic Extraction Reagents Kit. Proteins in the ...
and information is subsequently relayed to the hypothalamic PVN, where its anorectic effects are mediated. Direct injection of OXM into the ARC, even at very low doses caused a robust and sustained inhibition of food intake, further supporting the hypothesis that that the ARC is the site of th...
E (dl-α-tocopheryl acetate), 20 IU; vitamin K3 (menadione sodium bisulfate), 2 mg; thiamin (thiamin mononitrate), 1.5 mg; riboflavin, 8 mg; pyridoxine hydrochloride, 3 mg; cobalamin, 0.02 mg; calcium-d-pantothenate, 10 mg; nicotinic acid, 50 mg; folic acid, 1 mg; biotin, 0.2 mg...
(a) Confocal image of an NIH3T3 cell expressing genome-edited caveolin-1-GFP and FYVE-mCherry, labelled with streptavidin to detect internalized sulfo-NHS-SS-biotin after 15 min uptake. The boxes denote regions shown inb. Bar is 15 μm. (b) Examples of caveolin-1-GFP-positive endoso...