Introduction of the MASH1 gene into mouse embryonic stem cells leads to differentiation of motoneuron precursors lacking Nogo receptor expression that can ... ES cells transfected with the MASH1 gene yielded purified spinal motoneuron precursors expressing HB9 and Islet1. The cells lacked the expres...
Functional differences between mouse oocyte and preimplantation embryos – intra-species comparative transcritpomics To study the functional differences among transcriptomes from the same species, we applied GO-Diff to analyze dbEST libraries of mouse-unfertilized eggs and different developmentally staged mous...
Through 10.4" touch screen display and user-friendly operating system, Hemo 5800V supports 10 kinds of animal species including dog, cat, horse, pig, cattle, sheep, rabbit, monkey, rat, mouse and 10 user-defined species which can meet various requirements. Automated user-fr...
Resmetirom was negative in thein vitrobacterial reverse mutation (Ames) assay, thein vitrochromosomal aberration assay in human peripheral blood lymphocytes, thein vitromicronucleus assay in L5178Y tk+/-mouselymphomacells, and thein vivorat micronucleus assay. ...
between two conditions from single-cell transcriptomics data. Built upon scDiffCom, scAgeCom is an atlas of age-related cell–cell communication changes covering 23 mouse tissues from 58 single-cell RNA sequencing datasets from Tabula Muris Senis and the Calico murine aging cell atlas. It offers...
13 animal types including Dog, Cat, Horse, Monkey, Ferret, Rat, Mouse, Rabbit and Pig, Cow, Llama, Goat and Sheep Utility 10.4 inch TFT touch screen with a wide viewing angle maximizes convenience for clinicians. Users can complete all instru...
Risio M. Apoptosis, cell replication, and Western-style diet-induced tumorigenesis in mouse colon. Cancer Res. 1996;56:4910–6. CASPubMedGoogle Scholar Santella L. The roles of calcium in the cell cycle: facts and hypotheses. Biochem Biophys Res Commun. 1998;244:317–24. ...
Animal Type cat, dog, horse, mouse, rat, rabbit, pig, cow, monkey, sheep, plus 5 user-defined animal settings Methodology Electrical resistance for counting, hemoglobin cyanide method and SFT method for hemoglobin Parameter 3-part differentiation of WBC; 20 parameters and...
Mouse ATGGCCTACCCATTCCAACTTGGTCTACAAGACGCCACATCCCCTATTATAGAAGAGCTA Rat ATGGCTTACCCATTTCAACTTGGCTTACAAGACGCTACATCACCTATCATAGAAGAACTT Seal ATGGCATACCCCCTACAAATAGGCCTACAAGATGCAACCTCTCCCATTATAGAGGAGTTA Whale ATGGCATATCCATTCCAACTAGGTTTCCAAGATGCAGCATCACCCATCATAGAAGAGCTC Frog ATGGCACACCCATCACAATTAGGTTTTCAAG...