SI 2015/1637 Deregulation act 2015 (health and safety at work) (general duties of self-employed persons) (consequential amendments) order 2015Legislation UK
legislation.gov.uk 相似文献Explanatory notes to the Deregulation act 2015. Ch 20 C Office 被引量: 0发表: 2015年 TRADE LIBERALIZATION AND PRICE-COST MARGIN IN INDIAN INDUSTRIES The paper notes that despite the pro-competitive effects of trade liberalization reinforced by domestic industrial deregulati...
Noun1.deregulation- the act of freeing from regulation (especially from governmental regulations) deregulating freeing,liberation,release- the act of liberating someone or something Based on WordNet 3.0, Farlex clipart collection. © 2003-2012 Princeton University, Farlex Inc. ...
Just when they looked ready to become tidy, the status of deregulation issues concerning the UK National Transmission System (NTS) and Pipelines Act of 1962 may be up in the air again. The culprit this time is the British electoral process. At press time, Prime Minister John Major (Conservat...
Assessment of miRNA expression patterns has shown that they can act as oncogenes or tumor suppressors and display up- or downregulated expression patterns in many human tumors [65]. It has been documented, for example, that DCIS tissue lesions exhibits a general upregulation in miR-21 expression...
level of ATP12A cause the decreased level of apoptosis in those blastocysts. The lower expression of ATP12A could act as counteracting the early stages of apoptosis in blastocysts derived from oocytes collected from prepubertal heifers and facilitates a metabolically quiet phenotype. As Singh et al....
Biodiversity contributes to the ecological and climatic stability of the Amazon Basin1,2, but is increasingly threatened by deforestation and fire3,4. Here we quantify these impacts over the past two decades using remote-sensing estimates of fire and def
thereof.Footnote24However, the sui generis system in China, namely the 1997 Regulation, was based on the 1978 Act of the UPOV Convention, which has limited scope and extent of protection compared to the 1991 Act of the UPOV as well as legislative updates in other regions, such as the EU....
This finding is important as plasma PCSK9 levels have been shown to act as predictors of treatment response to statin therapy.39 DISCUSSION We used a cross-tissue, cross-phenotypic and translational approach to establish that alcohol exposure leads to methylation variation in the promoter region of...
The full coding region of HADHA was amplified from cDNA prepared from healthy control fibroblasts (Ctr2) and LCHADD patient #5 by PCR using the primers HADHA_fwd (TATAGTCGACTCAAGATGGTGGCCTGCC) and the HADHA_rev (TATAGCGGCCGCTGACTGAGCGAGGCATGAGG). The PCR product was then cloned into the...