The larger PCR product in the mutant samples is due to retention of a short region of a downstream intronic sequence after exon 27, where an alternative splice donor is used. EGFR protein after residue 1,091 is not translated due to a frameshift leading to a stop codon. c, Western ...
We introduced an iBAR barcode into the gRNA stem-loop86, by using a primer with a hexanucleotide degenerate sequence (Sigma Aldrich) to amplify the oligo library (Twist Biosciences). This enables the identification of genetically identical clonal populations of daughter cells expressing the same ...
Our work provides the largest to date exploration of genetic influences on cell morphology (what we term cmQTLs). Where previous studies have been limited by both sample size and the scale of morphological measurements, we combined whole genome sequence analysis with Cell Painting to define relation...
As expected, E5-F1 contacts continue into the minor pseudopilin complex in the following sequence: XcpG-XcpH-XcpJ-XcpI-XcpK. This arrangement maintains the right-handed nature of the major pseudopilin filament structure. In the filament model, the average distance between the E5 carboxyl ...
(TGAGCAAAGACCCCAACGAG), introducing an extra PCR step using a targeted primer (8 cycles using Phusion 2X master mix; Thermofisher; primer sequence = TCG TCG GCA GCG TCA GAT GTG TAT AAG AGA CAG NNN Ntaa ccg ttg cta gga gag acc atat), and 1.2X bead purification (Agencourt AMPure XP)...
(Fig.4A). Compared to the poorly differentiated cholangiocyte progenitor cell cluster C0, C4 was more differentiated, as shown by their pseudotimes (Fig.4B). Unexpectedly, although the cells in C4 highly expressed genes enriched in cholangiocyte functions, enrichment of genes in hepatocyte ...