This perturbation score is calculated by first identifying genes that display evidence of differential expression between pre- and post-infection time points, calculating the difference of pseudobulk expression vectors of these genes between pre- and postinfection time points, and finally projecting the ...
To identify transcription factors controlling the temporally distinct changes in chromatin accessibility, we analyzed the DNA sequence within each cluster of accessible regions to find differentially enriched motifs (Fig. 3A). This analysis revealed unique sets of TFs predicted to bind to the various ...
The larger PCR product in the mutant samples is due to retention of a short region of a downstream intronic sequence after exon 27, where an alternative splice donor is used. EGFR protein after residue 1,091 is not translated due to a frameshift leading to a stop codon. c, Western ...
(TGAGCAAAGACCCCAACGAG), introducing an extra PCR step using a targeted primer (8 cycles using Phusion 2X master mix; Thermofisher; primer sequence = TCG TCG GCA GCG TCA GAT GTG TAT AAG AGA CAG NNN Ntaa ccg ttg cta gga gag acc atat), and 1.2X bead purification (Agencourt AMPure XP)...
As expected, E5-F1 contacts continue into the minor pseudopilin complex in the following sequence: XcpG-XcpH-XcpJ-XcpI-XcpK. This arrangement maintains the right-handed nature of the major pseudopilin filament structure. In the filament model, the average distance between the E5 carboxyl ...
63. In this study, we pseudo-bulked single-cell profiling data to generate per-donor trait scores. It will be interesting for future work to examine morphology at the single-cell level, similar to single-cell RNA sequencing approaches to better understand genetic influences on cellular ...
(Fig.4A). Compared to the poorly differentiated cholangiocyte progenitor cell cluster C0, C4 was more differentiated, as shown by their pseudotimes (Fig.4B). Unexpectedly, although the cells in C4 highly expressed genes enriched in cholangiocyte functions, enrichment of genes in hepatocyte ...