Leave a Reply Your email address will not be published.Required fields are marked* Comment Name* Email* Website Save my name, email, and website in this browser for the next time I comment. Post Comment Δ
Primer: T7-dsATX2 #1 Reverse: taatacgactcactataggg GGCGGCACTATCCAATTCTA Lim and Allada, 2013a (Macrogen) N/A Primer: T7-dsATX2 #2 Forward: taatacgactcactataggg CCGGTGGTTAAGAAGCATGT Lim and Allada, 2013a (Macrogen) N/A Primer: T7-dsATX2 #2 Reverse: taatacgactcactataggg GAATTG...
Are the Rocky Mountains a convergent boundary? What happens to the Earth at a divergent boundary? What are the three types of convergent plate boundaries? How would you describe the motion of plates in a divergent boundary? Is a convergent plate boundary a reverse fault boundary? How can conve...
Application Crash (0xc0000005) fault offset 0x00000000000022e7 Application crash due to ntdll.dll Application crash with "ntdll.dll" Application Error - Faulting module name: KERNELBASE.dll, version: 6.1.7600.16385 Are there any base64 encoding/decoding libraries ? argc and argv in Visual C++ Argum...
Program terminated with signal 11, Segmentation fault. #00x00007f062ce0d094in std::mem_fun1_t<int, boost::spirit::classic::impl::grammar_helper_base<boost::spirit::classic::grammar<boost::property_tree::json_parser::json_grammar<boost::property_tree::basic_ptree<std::stri...