Kerala becomes the first state in India to launch uniform gold prices based on the bank rate. The decision to introduce a uniform price on 916 purity 22-carat gold has been taken at a meeting between officials of Malabar Gold and Diamonds, one of the largest gold and diamond retail chains...
The 26 million-carat production increase in 2017 was the largest single-year volume increase since 1986, and it created a surplus that affected the entire value chain. As a result, inventory in the mining and midstream markets increased through 2019. Prices and revenues declined in both segments...
RdRp_SARSr-R CARATGTTAAASACACTATTAGCATA Use 800 nM per reaction E E_Sarbeco_F ACAGGTACGTTAATAGTTAATAGCGT Use 400 nM per reaction E_Sarbeco_P1 FAM-ACACTAGCCATCCTTACTGCGCTTCG-BBQ Use 200 nM per reaction E_Sarbeco_R ATATTGCAGCAGTACGCACACA Use 400 nM per reaction N N_Sarbeco_F CACA...
Similarities between SARS-CoV-2 and HCV, another RNA virus with an important mutation rate, have been analyzed in order to pursue drug repurposing. Both are RNA viruses, with a similar effect on immune response, comparable structure of the protease, and ion channels (protein E for SARS-CoV-...
The gold standard appears to be the combination of LC with tandem MS. However, despite their many advantages, these techniques also have drawbacks. A large amount of DNA is needed [92], as well as proper preparation of the DNA for testing, which causes artificial oxidative changes. Another ...