Nucleotide alphabet, specified as"DNA"or"RNA". If"DNA", the function usesA,C,G, andT. If"RNA", the function usesA,C,G, andU. Data Types:char|string Output Arguments collapse all Nucleotide sequence, returned as a character vector. ...
Recent in silico analysis has revealed the presence of a group of proteins in pro and lower eukaryotes, but not in Man, that show extensive amino acid sequence similarity to known O6-alkylguanine-DNA alkyltransferases, but where the cysteine at the putative active site is replaced by another ...
Explain the process of RNA being translated into proteins. Does tRNA match up with the RNA to make codons? During transcription of mRNA what base pair changes? What happens during RNA splicing? The complementary mRNA strand synthesized from the DNA sequence of CTGAC would be ...
AminoSeeNoEvil (or just AminoSee) is a DNA visualisation that assigns a unique colour hue to each amino acid and start/stop codon in the sequence, and then projects it into 2D and 3D space using an infinite mathematics space-filling function called the "
The sequences of the mutants were confirmed by DNA sequencing. The recombinant expression and purification of the mutants were performed by the same methods used for the wild type enzymes. Preparation of 14C-Labeled Substrates [2-14C]MVA and [2-14C]MVA-5-PP were enzymatically synthesized from ...
DNA and protein sequences additional residues underlined; the Strep-Tag sequence is in bold. ClyA-AS ATGACGGGTATCTTTGCGGAACAGACGGTGGAAGTTGTGAAAAGTGCGATTGAAACGGCTGACGGTGCGCTGGACCTGTATAATAAATATCTGGATCAGGTCATCCCGTGGAAAACCTTTGACGAAACGATTAAAGAACTGAGCCGTTTCAAACAGGAATACAGTCAAGAAGCGTCCGTCCTAGTGGGCGATATCAA...
(Fig.1b). Using GRIT, we also visualized the distribution of TAG sites throughout the 24 human chromosomes (Fig.1c). In addition to core functions related to recoding, GRIT can be used more generally for informatics involving coding DNA sequences, chromosomal sequences, gene essentiality, ...
All molecular biology is based on a central dogma: DNA codes for RNA which then codes for protein (amino acid) production. This concept is universal across all living organisms. Some biological entities will only possess RNA (like viruses, for example) but this p...
--peptide <string>Thestringis a valid one or three letter sequence.convert a one-letter sequence to a molfile:molconvert --peptide FFKMLL mol -o peptide.mol Export options peptide:3three-letter sequenceconvert SMILES representation to a three-letter sequencemolconvert peptide:3 -s "CC@HC(O...
(Figure1). This granularity ranges from very fine, at the level of DNA microarrays (tens of bases in length, containing probe level information relevant to only a short region of the corresponding mRNA molecule) through coarser granularity with sequence reads (few hundreds), transcripts (...