2000. Complement components of the innate immune system in health and disease in the CNS. Immunopharmacology 49:171-186. http://dx.doi.org /10.1016/S0162-3109(00)80302-1.Gasque, P. et al. (2000) Complement components of the innate immune system in health and disease in the CNS. ...
摘要: In adult mammals trauma to the central nervous system (CNS) results in extensive neuronal death with virtually no regeneration or recovery of function. Regeneration in the peripheral nervous system...关键词: Humans Smoking Public Health International Cooperation Social Control Policies World ...
This chapter describes a rapid isolation procedure that reproducibly yields highly active microsomal membranes, and presents method for refining the crude ... P. and Walter,G Blobel - 《Methods Enzymol》 被引量: 1416发表: 1983年 Synthesis and incorporation of myelin polypeptides into CNS myelin Th...
Proteomic interrogation of the meninges reveals the molecular identities of structural components and regional distinctions along the CNS axis Elise Santorella, Jeremy L. Balsbaugh, Shujun Ge, Parisa Saboori, David Baker & Joel S. Pachter Fluids and Barriers of the CNS volume 20, Article number:...
Immunological events occurring in the central nervous system (CNS) as a result of head trauma are largely unexplored. We report here that the levels of the alternative pathway complement proteins C3 and factor B are elevated in the cerebrospinal fluid (CSF) of head-injured patients. C3 and fact...
Neuronal aggregates involved in conscious awareness are not evenly distributed throughout the CNS but comprise key components referred to as the neural network correlates of consciousness (NNCC). A critical node in this network is the posterior cingulate, precuneal, and retrosplenial cortices. The ...
Submicroscopic Morphology and Function of Glial Cells1 This chapter discusses the submicroscopic analysis or ultrastructure of the two more important types of glial cells of the central nervous system (CNS)鈥 namely, astroglia and oligodendroglia. The morphological data on astroglia are disc... E ...
A ~5-kb section of human EXOC7 locus was amplified with primers (F: AAGGACTGAAGGAGCATTTC, R: CAGGGAGTCGAAGGTCTTCT) from a BAC and cloned into pCAG expression vector. The splice acceptor variant from family I was introduced with site-directed mutagenesis. Wild-type (WT) or splice varian...
摘要: The structures and functions of proteoglycans are discussed, emphasizing those from cartilage. Various roles are considered for proteoglycans in the mechanisms of mineralization of cartilage matrix and osteoid during endochondral bone formation....
Alterations in extracellular matrix (ECM) expression in the central nervous system (CNS) usually associated with inflammatory lesions have been described in several pathological situations including neuroblastoma and demyelinating diseases. The participa