Twin and family studies in autistic disorders (AD) have elucidated a high heritability of the narrow and broad phenotype of AD. In this review on the genetics of AD, we will initially delineate the phenotype of AD and discuss aspects of differential diag
The primer sequences for CD27 and GAPDH were as follows: human CD27-Forward: 5′-GGACAAGCAGTGACCATCAAG-3′; human CD27 -Reverse: 5′-CCCAGAATTACCAAGTGAGTCCT-3′; human GAPDH-Forward: 5′- TGACTTCAACAGCGACACCCA −3′; human GAPDH -Reverse: 5′- CTACATGGCAACTGTGAGGAG −3′. ...
have been broadly studied in TP53-mediated tumour suppression [8,14,15,16,17,18,19], numerous others still have an unknown relevance in the TP53 network. Several studies have uncovered the importance of such undervalued players of TP53-dependent tumour suppression, including ZMAT3 [20,21,22,23...
Sample information and mRNA datasets for both the TCGA and METABRIC breast cancer specimens were retrieved from https://portal.gdc.cancer.gov/ and http://www.cbioportal.org/. Survival data for independent datasets were downloaded from http://kmplot.com/analysis. Codes used in this study were ...