Located in the City of San Jose, Santa Clara County (Silicon Valley), the District encompasses 180 square miles, which geographically parallels approximately 14 miles of the East Foothills of the Valley. Located in the City of Tshwane, TASEZ is a multi-billion project between the Department of...
Subdivision (c) of section 65590 also imposes a mandatory duty on local governments to require replacement housing when they determineanyresidential structure is no longer feasible in a certain location and permit a noncoastal dependent use to be built in its place. This subdivision provides: "The...
City Of Cupertino. Online Forms All Agendas and Minutes. Radio Cupertino (1670 AM). Job Descriptions and Salary Schedule. Planning Permit Application Form. Development Activity and Projects. Signage and Special Events. Inspection Requirements and Procedures. Installation and Replacement Procedures. Agendas...
1.A method of producing a genetically modified mouse, the method comprising inserting DNA into a genome of a mouse using a vector, the vector comprising:a M71 odorant receptor (OR) transgene backbone;at least four sequential repeats of a DNA sequence that is 5′ ACATAACTTTTTAATGAGTCT 3′ (...
The southern chicken chain filed an application with Redwood City in December 2018. The city deemed it to be an "architectural permit," which didn't require anything beyond approval from planning department staff. "This would not go before the city council--because it's an...
Increment of efficiency and flexibility: Driverless vehicles will permit flexibility in operations for transit and taxis, but this could generate a social problem (unemployment). In private AVs, this reduction of cost is not relevant. Road capacity increment: Previous papers show different results [7...