Genotype-specific regions of the genome were ampli- fied via PCR utilizing primers described in the original publications (Cre: TCCGGGCTGCCACGACCAA, GGCGCGGCAACACCATTTT, CBP: CCTCTGAAGG AGAAACAAGCA, ACCATCATTCATCAGTGGACT) and a TAQ-Polymerase (Promega) based standard reac- tion mixture. ...
The mouse α1-tubulin (MGI 98869), gfap (MGI 95697), S100β (MGI 98217), mbp (MGI 96925), plp2 (MGI 1298382), or β-actin (MGI 87904) TATA box promoter regions of the un-cross-linked DNA was subjected to real-time qRT-PCR amplification, with primers described in the Supplemental...
The protein contains three zinc finger motifs of the C2H2 type, which is found in many transcription regulatory proteins (49) including Sp1 (50), WT1 (51), NGFI-A (52), MBP-1 (53), MBP-2 (54), and Krox-20 (55), and have been demonstrated to interact with DNA. The zinc finger...