Dialysis-related amyloidosis (DRA). This is more common in older adults and people who have been on dialysis for more than 5 years. This form of amyloidosis is caused by beta-2 microglobulin deposits that build up in the blood. Deposits can build up in many different tissues, but they mos...
The net effect is the appearance of large numbers of abnormal cells capable of forming bodily masses, or tumors, with the capacity to advance locally and invade adjacent tissues and organs or spread either through the lymphatics or the blood vessels into distant organs. The ultimate effect of t...
Human Insulin Receptor (IRS) and Beta- 2 microglobulin (hβ2M). hβ2M was used as a housekeeping gene. Ann. T(°C): Annealing temperature. C: Number of cycles. Gene (Accession number)Sequence (5′-3′)Ann. T (°C)C hIRS (NM_001185098.1) FWD: CTGCATCAGAAGAGGCCATCA 63 30 RVS:...