Six-week-old, specific pathogen-free athymic NCr-nu/nu mice were purchased from Charles Rivers or from the Animal Production Area of the National Cancer Institute-Frederick Cancer Research and Development Center (Frederick, MD). The care and use of laboratory animals was in accordance with the ...
Invasive breast cancer (BrCa) is predicted to affect 1 in 9 women in a lifetime;1 in 32 will die from this disease. The most aggressive forms of BrCa, basal-like/triple-negative phenotype (TNBC), are challenging to treat and result in higher mortality du
Three-month-old uniparous MMTV-Myc female mice (NCI Frederick Mouse Repository, Frederick, MD, USA) (30 mice/group) were fed with 0.3 mg/kg/day of the RARa agonist Am580 (4-[(5,6,7,8-tetrahydro-5,5,8,8-tetramethyl-2-naphthyl)carboxamido]benzoic acid), which was kindly provided by...
cDNA was amplified with target-specific primers (GAPDH-Forward: 5′-CCCCTTCATTGACCTCAACTACA-3′, Reverse: 5′-CGCTCCTGGAGGATGGTGAT-3′; mouse BST-2-Forward: TCAGGAGTCCCTGGAGAAGA, Reverse: ATGGAGCTGCCAGAGTTCAC; human BST-2 RT2 qPCR Primer Assays (SABiosciences, Frederick, MD, USA). RT...
Building a Community-Based Cancer Center Program July 2011 Jeffrey S. Kneisl, J. Benjamin Jackson III Breast Conservation Therapy Versus Mastectomy in the Community-Based Setting: Can This Rate Be Used as a Benchmark for Cancer Care? July 2011 Marsha Criscio Nelson,…, Frederick L. Greene Amer...
Laboratory of Cancer Immunometabolism, Center for Cancer Research, National Cancer Institute, National Institutes of Health, Frederick, MD, USA Veena Somasundaram & David A. Wink Contributions MF designed the experiments, performed most of the experimental works, data analysis, and prepared the manuscrip...
Frederick R. Adler Contributions R.E. carried out experiments, was involved in their analysis, and wrote the manuscript. J.I.G. and F.R.A. carried out the mathematical modeling and facilitation analysis and wrote the manuscript. V.K.G. generated cell lines, performed experiments, and develop...
BALB/c mice were obtained from National Cancer Institute (Frederick, MD). All studies are approved by the Georgia Regents University Institutional Animal Care and Use Committee (Protocol# 2011–0365). Cell lines All human cell lines established from primary and metastatic colon and breast cancer ti...
Ueno NT, Buzdar AU, Singletary SE, Ames FC, McNeese MD, Holmes FA, Theriault RL, Strom EA, Wasaff BJ, Asmar L, et al. (1997). Combined-modality treatment of inflammatory breast carcinoma: twenty years of experience at M.D. Anderson Cancer Center. Cancer Chemother Pharmacol 40: 321-...
Andrea Blacklock & Frederick L. Baehner Medical Affairs – Exact Sciences, Redwood City, CA, USA Christy Russell Global Medical Affairs, Eli Lilly and Company, Basingstoke, UK Francisco Sapunar Lilly Corporate Center, Indianapolis, IN, 46285, USA Francisco Sapunar Contributions MC, SW, AB, RB...