is obtained by using a positive primer P1:5'ATGTGGAAGCTTAAGATAGCGGA3' and a reverse primer P2:5'TTAGGTGCCAAGGGACGGTGAT3', and taking a panax japonicas cDNA library as a template to amplify; the sequence of the panax japonicas beta-amyrin synthase gene is as shown in SEQIDNO.1. The...
By manipulation of two key enzymes in the pathway, 3-hydroxy-3-methylglutaryl-CoA reductase and lanosterol synthase, we have improved beta-amyrin production by 50%, achieving levels of 6 mg.L-1 culture. As we have observed a 12-fold increase in squalene levels, it appears that this strain...
By manipulation of two key enzymes in the pathway, 3-hydroxy-3-methylglutaryl-CoA reductase and lanosterol synthase, we have improved beta-amyrin production by 50%, achieving levels of 6 mg.L-1 culture. As we have observed a 12-fold increase in squalene levels, it appears that this strain...
Expression of two key biosynthetic enzymes for terpenoid biosynthesis (squalene synthase and beta-amyrin synthase) was analyzed in licorice as a model organism. For two elicitors, methyl jasmonate (MeJa) and salicylic acid (SA), the roots of 65-day-old plantlets treated with a combination of ...
Molecular cloning and functional expression of triterpene synthases from pea (Pisum sativum) New α-amyrin-producing enzyme is a multifunctional triterpene synthase. Eur. J. Biochem. 2000, 267, 3453–3460. [Google Scholar] [CrossRef] Martelanc, M.; Vovk, I.; Simonovska, B. Determination of...