Since CNK2 functions at the plasma membrane, we hypothesized that its localization could be regulated by growth factors and their receptors. Consistent with this idea, membrane staining of endogenous CNK2 in U2OS cells was strongly reduced by serum starvation (Fig.6a; Supplementary Fig.8a). Since...
Currently, the only functional information regarding the ARL2/BART interaction is in the nucleus, where BART and ARL2 facilitate STAT3-mediated transcriptional activation, as depletion of BART decreased the levels of phosphorylated STAT3 and transcription of STAT3 target genes following stimulation of ...
ACCCGTTTCGA TCTCAACTTCT; HDAC11: CACGCTCGCCATCAAGTTTC, GAAGTCTCGCTCATGCCCATT; glyceraldehyde 3-phosphate dehydrogenase (GAPDH): ACAACTTTGGTATCGTGGAAGG, GCCATCACGCCACAGTTTC), and SYBR Green (Thermo Fisher Scientific, ref. 4367659). Target gene expression was normalized to the levels of GAPDH....
2 a) and its transcriptional activity as judged by the increased expression of the p53 target gene, p21Cip1/WAF1(Fig. 2 a) and the elevated activity of a reporter plasmid containing concatamerized p53 binding sites in front of the firefly luciferase gene (Fig. 2 b). This observation ...
Without knowledge of the Arf gene at the time they initiated their experiments, and with an understanding that mutations in cancer cells frequently target exon 2 of the human INK4a gene, Serrano and coworkers (1996) ablated exon 2 of the Ink4a gene in the mouse germ line, inadvertently ...
is a novel functional and molecular mechanism and a possible therapeutic target for HCC metastasis. Altogether, our results illustrated DDR1, ARF6 and PSD4 promoted the migration, invasion and metastasis of HCC cells in vitro and in vivo, we also discovered that DDR1 promoted HCC metastasis thro...