The Union Budget 2025 has introduced a national framework aimed at driving the growth of GCCs in tier-II cities. This framework focuses on talent development, infrastructure upgrades, workforce upskilling, and AI-focused Centres of Excellence for agriculture, health, and sustainable cities. The initi...
Supply chain bottlenecks have become more commonplace in recent years, such as those seen during the COVID pandemic or the disruption to grain exports as a result of the Russia-Ukraine conflict. This is a particular concern for import-dependent countries such as those of the GCC, ...
Number of readers of the magazine who returned service cards requesting information on the GCC; Indication that 1,100 readers were from the United States; Country in which the greatest interest in the...
Quantitative real-time RT-PCR was performed with cDNA samples from RCC 786-O stable clones. The amplification reactions of 40 cycles were carried out with specific primers for VEGF (upper: 5´ AGCTACTGCCATCCAATCGA 3´ lower: 5´ GGTGAGGTTTGATCCGCATA 3´), and RPL19 (upper: 5′ ...
Once this requirement is met one can download the STIR sources in a .zip compressed file and then use the GNU make utility to compile the program to be run. The recommended compiler is GNU gcc but the use of other ones is also possible such as the free version of the Visual C++ ...
By accepting optional cookies, you consent to the processing of your personal data - including transfers to third parties. Some third parties are outside of the European Economic Area, with varying standards of data protection. See our privacy policy for more information on the use of your perso...
PT Bank National Nobu GlobalSign truly stands out as our SSL certificate provider of choice through these years with its outstanding customer education and support, which is hailed as the benchmark for our other outsourced service partners. Their value-added toolbox which automates our certificate ...
"Newspapers will have you hating the people who are being oppressed, and loving the people who are doing the oppressing" - Malcolm X
ESG investing is at a critical moment. As historical levels of capital are fed into ESG funds, questions emerge on how useful ESG data is. Find out more. 14 Jul 2022Katie Kummer+ 1 Why biodiversity may be more important to your business than you realize ...
A proto-oncogene is a normal gene that presents a potential to become an oncogene after a genetic alteration (mutation), leading to an increased expression. Usually, proto-onco‐ genes code for proteins that control cell growth and differentiation through signal transduc‐ tion and execution of ...