Combining the synthetic ancestor genome with bovine DNA had frustrated her, so she'd developed a template of human DNA to provide comparative analysis. It helped some, but not enough. She found it ironic that if they could use a human host, particularly Jian herself, they would have ...
The concept of a last universal common ancestor of all cells (LUCA, or the progenote) is central to the study of early evolution and life's origin, yet information about how and where LUCA lived is lacking. We investigated all clusters and phylogenetic t
COPI-β reverse: AAGCTTCGCGTCGGCCTTGA; PDI forward: CATATGAAGTGGCAGTACATCG, PDI reverse: AAGCTTGAGCTCCTTCTTCTCCCC) usingM. balamuthicDNA as template. The PCR products were subcloned
the corresponding gene sequences were amplified by PCR (Primers: COPI-β forward: CATATGAAGAACCTCGAGCACAGG, COPI-β reverse: AAGCTTCGCGTCGGCCTTGA; PDI forward: CATATGAAGTGGCAGTACATCG, PDI reverse: AAGCTTGAGCTCCTTCTTCTCCCC) usingM. balamuthicDNA as template. The PCR products were subclo...