BEIJING, Dec. 12 (Xinhua) -- The GCC (the Gulf Cooperation Council) countries and Iran are all China's friends, and neither China-GCC relations nor China-Iran relations are targeted at any third party, a Chinese Foreign Ministry spokesperson said on Monday. Spokesperson Wang Wenbin made the ...
The discovery of oil in the 1960s dramatically increased wealth and stimulated economic growth and development, and the GCC countries now have the highest per capita GDP in the world. This situation led to a massive increase in population and economic growth that transformed the mud-walled cities...
The GCC is a regional organisation comprising six Arab countries: the Kingdom of Saudi Arabia, Qatar, Kuwait, the United Arab Emirates, the Sultanate of Oman, and Bahrain. The GCC Patent Office is a regional office that registers patents in the member states of the GCC. Patents granted by ...
* Other names and brands may be claimed as the property of others.Microsoft, Windows, and the Windows logo are trademarks, or registered trademarks of Microsoft Corporation in the United States and/or other countries.OpenCL and the OpenCL logo are trademarks of Apple Inc. used by permission ...
Location in array (well)Assay Name and product size (bp)Oligo namesOligo Sequence (5‘-3‘)Source Empty Cell Controls 1 Beta Actin Mix FAM(131) ACT-1005-F CAGCACAATGAAGATCAAGATCATC Toussaint et al. (2007) Empty Cell ACT-1135-R CGGACTCATCGTACTCCTGCTT Empty Cell ACT-1081-FAM FAM-TCG...
The syntax for the attribute statement is the same, except that the <identifier> names a primitive earlier in the compilation unit and the statement is placed in the global scope, instead of within a module. The semicolon is not part of a type attribute. Note that attributes are also ...
"Perhaps the bigger thing to consider is Eid is a massive surge in inbound travel from GCC countries, so that impacts things like hotel availability, costs etc." lovedogs1234 "xmas into new year is super expensive in Dubai. si get something booked sooner than later." Get in Shaun C "...
Record the values you enter for database names, usernames, and passwords. The Cloudera Manager installation wizard requires this information to correctly connect to these databases.To create databases for CDP, follow these steps:1. In the admin node, connect to PostgreSQL:...
Non-oil sectors drive robust growth in GCC countries According to a new World Bank's report, the region’s average inflation in 2024 remained low and stable at 2.1%, ... Africa Finance Corporation facilitates $200mn financing for BUA Group The financing, ap...
blocks. According to Cybernews researchers, the data lacked any indicators that could link it to a specific organization or company, making it impossible to pinpoint the origin of the leak. The information discovered contained the data with full names, dates of birth, gender and taxpayer numbers...