Evans, GA Athens, GA Savannah, GA Rome, GA Dalton, GA Stonecrest, GA Columbus, GA Warner Robins, GA North Carolina Chapel Hill, NC Cornelius, NC Asheville, NC Wilmington, NC Monroe, NC Greensboro, NC Jacksonville, NC Sanford, NC South Carolina Mount Pleasant, SC...
Jamie Lewis, Marc Evans, Aldo Bergamasco, Antonello Ferrari, Storm Marrero, Nikos Diamantopoulos, Deep Grounder, Virag, Seb Skalski, Donald Sheffey, Miss Bunty, Saxy Mr. S, Mike Scott, YASS, Manyus, Misteralf, Maiya, Saccao, Antonio Santana, Mark Stone, Natasha Watts, Patimoro, Diego Brogg...
Goh KL, Bhaskaran K, Minassian C, Evans SJ, Smeeth L, Douglas IJ. Angiotensin receptor blockers and risk of dementia: cohort study in UK Clinical Practice Research Datalink. Br J Clin Pharmacol. 2015;79(2):337–50. https://doi.org/10.1111/bcp.12511. Article CAS PubMed PubMed Central...
HC Evans,G Eyssartier,BW Ferreira,CN Figueiredo,F Liu,J Fournier,LV Galli-Terasawa,C Gil-Durán,C Glienke,MFM Gonçalves,H Gryta,J Guarro,W Himaman,N Hywel-Jones,I Iturrieta-González,NE Ivanushkina,P Jargeat,AN Khalid,J Khan,M Kiran,L Kiss,GA Kochkina,M Kolařík,A Kubátová,...
was used to normalize the mRNA expression. The relative amounts of each transcript were calculated using the comparative Ct (2-ΔΔCt) method. ForAce2qPCR (primers Forward: GTGCACAAAGGTGACAATGG and Reverse: GGCTGCAGAAAGTGACATGA), 12 controls and 19 AD individuals were used. We used a ...
Evans (Samson and Evans 1974). The sexual morph C. confragosa (Mains) G.H. Sung et al. described by Mains (1949) in Torrubiella, is linked to the type species Lecanicillium lecanii (Zimm.) Zare & W. Gams of Lecanicillium and considered to be a synonym of Akanthomyces (Kepler et ...
Evans HC, Holmes KA, Reid AP . (2003). Phylogeny of the frosty pod rot pathogen of cocoa. Plant Pathol 52: 476–485. Article CAS Google Scholar Evans HC, Stalpers JA, Samson RA, Benny GL . (1978). On the taxonomy of Monilia roreri, an important pathogen of Theobroma cacao in Sou...
HC Evans,Natural control of arthropods, with special reference to ants ( Formicidae ), by fungi in the tropical high forest of Ghana.Journal of Applied Ecologyhttps://doi.org/10.2307/2402003 (1974) 11(1): 37–49. Google Scholar 14. HC Evans,JPM Araújo,VR Halfeld,DP Hughes,Epitypificati...
Evans HC, Holmes KA, Reid AP (2003). Phylogeny of the frosty pod rot pathogen of cocoa. Plant Pathol 52: 476–485. Evans HC, Stalpers JA, Samson RA, Benny GL (1978). On the taxonomy of Monilia roreri, an important pathogen of Theobroma cacao in South America. Can J Bot 56: 2528...
A novel and simple technique is described for the calibration of satellite instruments for the measurement of atmospheric ozone. Ozone is generated in a ga... WF Evans,E Puckrin,D Dufour,... - 《Proceedings of Spie the International Society for Optical Engineering》 被引量: 9发表: 2003年 ...