Disease screening protocol for RN was well-established by Robbins et al. (1999), in which the reproductive index (RI) was calculated based on the number of nematodes at test termination (Pf) and initial infestation density (Pi) (RI = Pf/Pi). High level of RN resistance has been ...
Table 1.. PLEKHG5 Primers Used for gDNA and cDNA Sequencing Analyses, Plasmid Constructions, and Real-Time RT-PCR Empty CellPrimer Sequence (5′→3′) Analysis and Exon (GenBank Accession Number)ForwardReverse gDNA: Exon 1 (NM_198681) TCTGTGGTGTTGCTTTCCTG GCCTGCAAGTGGCTCTTAAA Exo...
In vitro analysis of post-fatigue reverse-torque values at the dental abutment/implant interface for a unitarian abutment design. J Prosthodont 2011; 20: 503-509. Jimbo R, Halldin A, Janda M, Wennerberg A, Vandeweghe S. Vertical fracture and marginal bone loss of internal-connection implants:...
However, our molecular understanding of neurological disorders such as neurodegenerative disease has mostly relied on reverse genetics (Lu and Vogel, 2009). Although some genes required for neuronal maintenance have been identified from genetic screens for viable mutations that exhibit shortened life span...
even a simple model can be expected to be useful for understanding the essential molecular dynamics in the tooth root morphogenesis. The inferences drawn from the simulation study were as follows: (1) spotted and reverse-spotted patterns can be produced depending on the saturation value of the ac...
The effects of nutrition in maintaining health and in the predisposition to periodontal disease has been gradually emerging in several studies that reported effects such as gin- gival bleeding reduction [5], reduced gingival inflammation [6] and reduced tooth loss [7]. 1 3Vol.:(0123456789) 4 ...
The same forward primer, used in combination with a reverse primer located across the breakpoint, yields product only from the mutant allele because the normal product would be too long (~3 kb) to amplify under assay conditions. Using this assay, all seven of the original affected calves, ...
Table 4) for clean drilling of CFRP laminates. The intermittent saw-tooth design was implemented and its performance was compared with normal one-shot drills. The saw-tooth design-based tool was observed to perform better in terms of the number of burr-free holes, approximately six times more...
the particular powder needs to be sprayed on the tooth surface to form a homogeneous layer after the mouth rinsing and air drying. This requirement makes the use of active wavefront sampling significantly less convenient and less comfortable for the patient, and the powder itself can affect the ...
“We will fight that effort tooth-and-nail. Any court, any place, Connecticut will be there and will fight.” The state is already involved in major abortion cases across the country. And while Connecticut is surrounded by mostly pro-abortion states, it’s still bracing for out-of-state ...