19 January 2022 © The Author(s) 2022 Abstract This paper builds on two leading models of artistic practice, the "network-building" and "autonomous sphere" approaches, to show how an expressive work can reverse the normal antinomy between artistic recognition and commercial success and become an...
Disease screening protocol for RN was well-established by Robbins et al. (1999), in which the reproductive index (RI) was calculated based on the number of nematodes at test termination (Pf) and initial infestation density (Pi) (RI = Pf/Pi). High level of RN resistance has been ...
Additionally, the oppositeEDAR370A effects between LM1s and LM2s may be attributed to the partitioning of the areas for the two adjacent teeth. The first stage of tooth development is the formation of the dental lamina. Then, the dental region is partitioned into compartments for incisor, cani...
Table 1.. PLEKHG5 Primers Used for gDNA and cDNA Sequencing Analyses, Plasmid Constructions, and Real-Time RT-PCR Empty CellPrimer Sequence (5′→3′) Analysis and Exon (GenBank Accession Number)ForwardReverse gDNA: Exon 1 (NM_198681) TCTGTGGTGTTGCTTTCCTG GCCTGCAAGTGGCTCTTAAA Exo...
Table 4) for clean drilling of CFRP laminates. The intermittent saw-tooth design was implemented and its performance was compared with normal one-shot drills. The saw-tooth design-based tool was observed to perform better in terms of the number of burr-free holes, approximately six times more...
Carboxy-terminus of Hsc70-interacting protein (CHIP) functions both as a molecular co-chaperone and ubiquitin E3 ligase playing a critical role in modulating the degradation of numerous chaperone-bound proteins. To date, it has been implicated in the reg
The same forward primer, used in combination with a reverse primer located across the breakpoint, yields product only from the mutant allele because the normal product would be too long (~3 kb) to amplify under assay conditions. Using this assay, all seven of the original affected calves, ...
However, our molecular understanding of neurological disorders such as neurodegenerative disease has mostly relied on reverse genetics (Lu and Vogel, 2009). Although some genes required for neuronal maintenance have been identified from genetic screens for viable mutations that exhibit shortened life span...
The effects of nutrition in maintaining health and in the predisposition to periodontal disease has been gradually emerging in several studies that reported effects such as gin- gival bleeding reduction [5], reduced gingival inflammation [6] and reduced tooth loss [7]. 1 3Vol.:(0123456789) 4 ...
“We will fight that effort tooth-and-nail. Any court, any place, Connecticut will be there and will fight.” The state is already involved in major abortion cases across the country. And while Connecticut is surrounded by mostly pro-abortion states, it’s still bracing for out-of-state ...