varMyTag=function(_HTMLElement){_inherits(MyTag,_HTMLElement);functionMyTag(){_classCallCheck(this,MyTag);return_possibleConstructorReturn(this,(MyTag.__proto__||Object.getPrototypeOf(MyTag)).apply(this,argument
Include the plyr.js script before the closing </body> tag and then call plyr.setup(). More info on setup() can be found under initialising.<script src="path/to/plyr.js"></script> <script>plyr.setup();</script>If you want to use our CDN (provided by Fastly) for the JavaScript, ...
In the Editor, enter the registered name as the tag name when adding the custom element to the site. Once registered, the custom element can be used on your site. The first parameter, hello-world, maps to the tag name, which will be defined in the Editor (step 8). The second ...
In programming, “recursion” is when a function calls itself, using its own output as an input to yield powerful results. Recursive Mono was used as a tool to help build itself: it was used to write Python scripts to automate type production work and to generate specimen images, and it ...
Tcl scripts can read the value of this command by using the info tag get cfg_avpair transfer-mode statement. For detailed information, see the Tcl IVR API Version 2.0 Programmer’s Guide . For VoiceXML applications, the value of this command becomes the default behavior if the com.cisco....
oKz7gZ0uITC4znnsPyG8TAgM6nwN 88uOCgQGd6ZknLqoOw4+6opo6CKkt6dtPrirHlCiXget+Ot8JSwDD7xGNfM9+B/s4YNjNqgED+r+ gz1QBvUVFg6KhA15QQQSLojAggtYYIIHEhpoABiowIIHhAUomMBs7Yd6Z1NrWcdvOqjTH72qDtNI uYVprdsapZ7ZOHXXO7XSo6Xdz3vY+cwOyUpwz34u9flsw8/q1fFFPDtr4dUJTUeZ6uDgwOieV8qs 4y5lUsVi...
tagUrl is a URL for a custom VAST tag if you're not using Vi. urls Object See source. If you wish to override any API URLs then you can do so here. You can also set a custom download URL for the download button. vimeo Object { byline: false, portrait: false, title: false, ...
CbNKEYJTb4S9WdxTAG+g+NmV8lCWia4OKLZQ6QtySc94L1XGcYderqLiAis8G6lxnrH84hZiTWcG H+EbKepm0Ic/Mg/MAU8UoY+mSlkR7N3PlPxnfchFNmQVujry7pqFEkG6vqw3OA/yBmsYUTTnkKJl Y1Hz/xILzwjULY+8zj8fuC2bH9lsuSBHzigxtHc/YV4megvfXGOOpZJZYLXS6YYeojb0dbCIw2Bp UUKKaOyq3dWDgEuCAzW6vv0Sktgq6EuQOLWTMD...
Primer sequences for genomic integration of the metabolic markers as follow: HIS3 Fw: 5’TATCGTTTGAACACGGCATT3’ and Rv: 5’CGCGCCTCGTTCAGAATGAC3’; LEU2 Fw: 5’GAATTAAAGGATTGGATAGC3’ and Rv:5’CCCTATGAACATATTCCATT3’; URA3 Fw: 5’GTTCATCATCTCATGGATCT3’ and Rv: 5’TACTGTT...
x-html Works similarly to x-bind, but will update the innerHTML of an element. x-ref Convenient way to retrieve raw DOM elements out of your component. x-if Removes an element completely from the DOM. Needs to be used on a <template> tag. x-for Creates new DOM nodes for each item...